DOF5, DOF5 (gene) Malus x domestica

Gene Overview
Name DOF5
Gene Symbol DOF5
Type gene
Organism Malus x domestica
Synonym DOF domain class transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DOF5HM122546.1-DOF5.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
DOF domain class transcription factorDOFMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122546.1-DOF5.m1 Chr15:24268419..24269460
chr15:21687024..21688065
HM122546.1

Sequence(s):
>HM122546.1-DOF5.m11041
atgatccaagaactgtttggaggtgcaggccttaataacatagcaggaggaggagagaggaaatcgctcacctttcatgg
tggtactacttcttctccttctctgtctccttcaccatccccttcttcctcaacaactaccaccgccaccgccaccacaa
cagccacggcaggtttatcaaatactgagaacttgagatgcccaagatgcgattcttccaacaccaagttctgctactac
aacaattacaacctcactcaaccccgccacttctgcaagacctgtcgccgctactggacaaaaggaggagccctccgcaa
cgttccaattggcggcggctatagaaaaaacaagagtgtcaccgggtcaacggcttccatagacaagaccgccgcaggga
agttgaaaacggtggtgtcagagattggccgttcaggatttggtgcggggttcgatcaggaggtccaagcaagcccaata
ctatggggctcgccccagaattctcatttactagccctgttaaaagccagtcatcatcaaaaccctaaccctaatcaact
ttgtaattctgtaaatgtgaaggaagagggaggtatgaatatgattgggtcccacatgatgactactgaggcaattgcaa
tgagtactgctcgaaccctgggtttggatccagtgtgccaggctccttcacttggcctgtgcagctctttctggagaaac
aacaaccaagatcaaccacctccaagccatcaccaacaaaacggtttcattgttggtcatgaagttcaaagcagcaatat
tggaattcaagaattgtttcagaggctaacaccatcaacatcacaatcatgtagttattattctgaccaactaaataatg
tggtggcgtcttcatcctcctcatcattgtcttcatattccacgtcatcgattttggattcgtctccggtggttggcggt
ggcgaaatgggttacagctggaacccggcgtttaccgcgtggtcatttgatcttccgacaaccaatggtgcatatcatta
a
back to top