IPT, IPT (gene) Malus x domestica

Gene Overview
Name IPT
Gene Symbol IPT
Type gene
Organism Malus x domestica
Synonym isopentenyltransferase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
IPTGU183552.1-IPT.m1Malus x domesticamRNA
IPTGU136289.1-IPT.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
isopentenyltransferaseIPTMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly GU183552.1-IPT.m1 Chr13:15366565..15367576
chr13:17680852..17681863
chr13:19721647..19722658
GU183552.1
predicted genes from whole genome assembly GU136289.1-IPT.m1 Chr03:13674109..13677524
chr3:13026649..13030064
chr3:14557936..14561351
GU136289.1

Sequence(s):
>GU183552.1-IPT.m11011
atgagaattctcatgtctgcctgcaaacaagtagtacagccgatggtgagcttccaaggccccgggctcaccaacataaa
catggatccgtttttacggcgaaaagataaggttgtgatcgtaatgggagccaccgggactggcaagtcccggcttgcca
tagacctcgcaagacataatccgccggcggagattattaactcggacaaaatgcaagtctacaaaggcttggacatcgtc
accaacaaagtcactgaggacgagtgtaaaggcatacctcaccatttgataggcaaagtcgatcccgactcagattttac
tgccaatgatttcaagcaccatgcgtcgttggccatcgaatcgatcttggagcgtgacagattgccaatcattgccgggg
gttcaaattcgtatattgaagccttggtggatgaacactcggagtttcgaatgaagtacgagtgttgctttctttgggtt
gatgtggccatccccgtgctccactctttcgtgtcagagagagtggaccggatggtgaagatgggtttggttgaagaggt
gaggagaatgtttgactctacaactgagaaagaatatacgcgcggagtcaggcgagccataggcgtgcctgaaatggatg
agtatttacaaggcgaagcaagtgataataacgatgatgaaactcaagagaggcttcttcaagcagcaatttctaaaatc
aaagaaaatacttgcattttggcgtatcgccaattgcaaaagattcgccggctgcaagctcggcggggttggaacatgca
ccgccttgatgccacggaggcgttcttaaagcaccacgcggaaacgaatcaagcgtgggaaaaactcgtggcaagacctg
ccacgcggatagtgcgtcagttccttttggacccaattccctccattcttccgacagagaatatcaccgccactaccacc
gctccggttctttccacgtctatgccgacagtgaccgctgcaacacgatag
back to top
>GU136289.1-IPT.m1648
atggaaagcagtgacgctgccattgaaacccagagaccccaaaaccatgaacccattgaagagaagccgaaggtggtggt
gataatgggacccacaggctcagggaagtcaaagctggccattgatttggcatcccacttccccgtggaggtcatcaacg
ctgattctatgcaggtctacagtggcttggatgttctcaccaacaaggtccctctgcacgaacaaaaaggagtggctcat
catctgctgggaactgtaagcccgaatgttgaattcacagcgaaagagtttcgggactctgccattcctctcatcaatga
catattatctcgcaactgcttgccggtcatagttggtggtaccaattactatatccaggctcttgttagtccattccttt
tagacgaaacagtagaagatattgatgaatgctgtttaggtgattatccaggagatggacaaccacaggctgagctggtt
attgaagtagacaattccagttatgactatgactatcttaaagccattgatccagttgcagcaaacagaatccatccaaa
gaaccatagaaaagtaagtttgtggcataatatgtactgtcgtcttgctgaatatatagtatgtgatgattttaaaatct
tttactag
back to top