|
Gene Overview
Name | S-RNase |
Unique Name | HM003189.1-S-RNase |
Type | gene |
Organism | Prunus scoparia () |
Source | genbank |
Genbank Note | ribonuclease S31; coding region not determined; contains first intron |
Analyses
This gene is derived from or has results from the following analyses
Cross References
External references for this gene
Alignments
Feature Name | Type | Location | Analysis |
HM003189 |
region |
HM003189:1..401+ |
NCBI Rosaceae gene and mRNA sequences |
Sequences
The
following sequences are available for this feature:
gene sequence >HM003189.1-S-RNase ID=HM003189.1-S-RNase; Name=S-RNase; organism=Prunus scoparia; type=gene; length=401bp mcttgttcttggttttgctttcttctwktgkttcattatgagcactggtg ggttgcattacaatyttttactgtttaaaatatgcatataatttgcmttg attttgkgttcgatgatatatatcatgtwwmggwggayttkkawctakmt cacaactttggswgagtaactacttrggcmttactttcwgcatgctttct ttcgtttactgtrayagywgtwgcaataagtgcrrcggaaawtatgttct ttwtgcmtcmaatccttatttaagataccattaaccttctcacaawaatt ttcgcaggakctwgatagtctattttcaatttgtgcccaatggcagtctc acaaaaatttggcaggatcttataactattttgantttgtgcaacaatgg c back to top
|