|
Gene Overview
Name | S-RNase |
Unique Name | HM003184.1-S-RNase |
Type | gene |
Organism | Prunus carduchorum () |
Source | genbank |
Genbank Note | ribonuclease S1/S3; coding region not determined; contains first intron |
Analyses
This gene is derived from or has results from the following analyses
Cross References
External references for this gene
Alignments
Feature Name | Type | Location | Analysis |
HM003184 |
region |
HM003184:1..336+ |
NCBI Rosaceae gene and mRNA sequences |
Sequences
The
following sequences are available for this feature:
gene sequence >HM003184.1-S-RNase ID=HM003184.1-S-RNase; Name=S-RNase; organism=Prunus carduchorum; type=gene; length=336bp mcttgttcttgstttygctttcttcttttgttacgttatgagcagtggtg ggttgcattacaatcttttgctctttatattctatatgcatataatcagc attgctttttttgttgagagaaactatattgtgtgtgttcgatcatatat atcacatgacatgtgctattgaatccacccacatatttttcatttagcgc acaattttctttggatgatcgtaagtatttgaggattgcttttcctgcat gttctctttttattttcatcctcatttctttattctgataattttggcag gatcttatgactattttcaatttgtncaacantggc back to top
|