|
Gene Overview
Name | S-RNase |
Unique Name | HM003182.1-S-RNase |
Type | gene |
Organism | Prunus geniculata () |
Source | genbank |
Genbank Note | ribonuclease S20; coding region not determined; contains first intron |
Analyses
This gene is derived from or has results from the following analyses
Cross References
External references for this gene
Alignments
Feature Name | Type | Location | Analysis |
HM003182 |
region |
HM003182:1..388+ |
NCBI Rosaceae gene and mRNA sequences |
Sequences
The
following sequences are available for this feature:
gene sequence >HM003182.1-S-RNase ID=HM003182.1-S-RNase; Name=S-RNase; organism=Prunus geniculata; type=gene; length=388bp mcttgttcttggtttngctttcttcttttgttacgttatgagcagtggtg ggttgcattacaatcttttgctctttatatatcctatatgcatatatata atcagcatattgcatttttctaattgtataatttgttgagagaattaact atattgtgtgtgttcgatgacatatcatgacatgcgctattgaatccaca cccacatatttttcatttaatctagcgcacaactttctttggatgagtaa gaatttggggatttcttttcctgcatgttctctttttattttcatcctct tttctttattctgataattgttgcagtctgttcatcacaataattttggc aggatcttatgactattttcantttgtncaacantggc back to top
|