|
Gene Overview
Name | LFY |
Unique Name | DQ073635.1-LFY |
Type | gene |
Organism | Rubus longisepalus var. tozawae () |
Source | genbank |
Analyses
This gene is derived from or has results from the following analyses
Cross References
External references for this gene
Alignments
Feature Name | Type | Location | Analysis |
DQ073635 |
region |
DQ073635:1..501+ |
NCBI Rosaceae gene and mRNA sequences |
Sequences
The
following sequences are available for this feature:
gene sequence >DQ073635.1-LFY ID=DQ073635.1-LFY; Name=LFY; organism=Rubus longisepalus var. tozawae; type=gene; length=501bp aaaccgggcatctttttttgtttttttttttttttgctaagaagcctgta ggttgtacgccagccatatgtagcttgaactgtgatggccacaatgctta gctattgccggtacccaagacgcctttggttgaatgttcacacctgatcc accgtctgcacttcctacattcactcccggaaattgaaacaggaaaacgg gaattgtaatctcccggtctgctgtagtcagcctcagggtgtgcctgact ggcgagtctgccgtctccacggcttcccggctgctcctcaagccttcgag tgccgatcttcgcttgggccgtctcgcgaagatcttcgatccgcatctac tctctcttagaggatgaaccacgccttcgctatcgaaagaatatagcgat cgaagagagctatcgctcagccgcttcgcgtattacttacgaaagccgta ttgcccgaagggggcatgctgcaagagcgtaggaatcgaattcccgcggc c back to top
|