MDC030484.9, MDC030484.9 (contig) Malus x domestica

Overview
NameMDC030484.9
Unique NameMDC030484.9
Typecontig
OrganismMalus x domestica (Apple)
Sequence length11809
Analyses
This contig is derived from or has results from the following analyses
Analysis NameDate Performed
Malus x domestica Whole Genome v1.0 Assembly & Annotation2012-07-26
Alignments
Feature NameTypeLocationAnalysis
MDP0000830882 mRNA MDP0000830882:7460..8044+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDP0000830882_exon_1 CDS MDP0000830882_exon_1:7460..8044+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
GDsnp00288 genetic_marker GDsnp00288:8446..8446. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_154698_Lg1_00288_MAF50_285078_exon1 genetic_marker RosBREEDSNP_SNP_CT_154698_Lg1_00288_MAF50_285078_exon1:8134..8134. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_151717_Lg1 genetic_marker RosBREEDSNP_SNP_GA_151717_Lg1:11113..11113. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_154323_Lg1 genetic_marker RosBREEDSNP_SNP_AG_154323_Lg1:8509..8509. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_154698_Lg1 genetic_marker RosBREEDSNP_SNP_CT_154698_Lg1:8134..8134. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_154771_Lg1 genetic_marker RosBREEDSNP_SNP_AG_154771_Lg1:8061..8061. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_154804_Lg1 genetic_marker RosBREEDSNP_SNP_AG_154804_Lg1:8028..8028. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_155589_Lg1 genetic_marker RosBREEDSNP_SNP_AG_155589_Lg1:7243..7243. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_156167_Lg1 genetic_marker RosBREEDSNP_SNP_TC_156167_Lg1:6665..6665. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_156201_Lg1 genetic_marker RosBREEDSNP_SNP_CT_156201_Lg1:6631..6631. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_156203_Lg1 genetic_marker RosBREEDSNP_SNP_CT_156203_Lg1:6629..6629. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_156204_Lg1 genetic_marker RosBREEDSNP_SNP_GA_156204_Lg1:6628..6628. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_156228_Lg1 genetic_marker RosBREEDSNP_SNP_GA_156228_Lg1:6604..6604. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_156231_Lg1 genetic_marker RosBREEDSNP_SNP_CA_156231_Lg1:6601..6601. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_156239_Lg1 genetic_marker RosBREEDSNP_SNP_AG_156239_Lg1:6593..6593. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_156247_Lg1 genetic_marker RosBREEDSNP_SNP_CT_156247_Lg1:6585..6585. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TC_156286_Lg1 genetic_marker RosBREEDSNP_SNP_TC_156286_Lg1:6546..6546. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_158280_Lg1 genetic_marker RosBREEDSNP_SNP_AG_158280_Lg1:4541..4541. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_158461_Lg1 genetic_marker RosBREEDSNP_SNP_GA_158461_Lg1:4360..4360. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_AG_158478_Lg1 genetic_marker RosBREEDSNP_SNP_AG_158478_Lg1:4343..4343. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TG_159263_Lg1 genetic_marker RosBREEDSNP_SNP_TG_159263_Lg1:3559..3559. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CA_159268_Lg1 genetic_marker RosBREEDSNP_SNP_CA_159268_Lg1:3554..3554. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_TG_159844_Lg1 genetic_marker RosBREEDSNP_SNP_TG_159844_Lg1:2978..2978. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_159856_Lg1 genetic_marker RosBREEDSNP_SNP_CT_159856_Lg1:2966..2966. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_159938_Lg1 genetic_marker RosBREEDSNP_SNP_GA_159938_Lg1:2884..2884. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_160144_Lg1 genetic_marker RosBREEDSNP_SNP_CT_160144_Lg1:2678..2678. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_CT_160223_Lg1 genetic_marker RosBREEDSNP_SNP_CT_160223_Lg1:2599..2599. Malus x domestica Whole Genome v1.0 Assembly & Annotation
RosBREEDSNP_SNP_GA_160842_Lg1 genetic_marker RosBREEDSNP_SNP_GA_160842_Lg1:1982..1982. Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr1 chromosome chr1:151292..163100- Malus x domestica Whole Genome v1.0 Assembly & Annotation
Sequences
The following sequences are available for this feature:

contig sequence

>MDC030484.9 ID=MDC030484.9|Name=MDC030484.9|organism=Malus x domestica|type=contig|length=11809bp
AGAATTAAAAAAAAAAAAAAAAAGGGAGACTGAAATTGGTATGCTTTTAC
TTTTGCCCGGCGATGCTTTCCATTAATTCTCTATGATTAAATGGATCAGG
TGCATGCAAGCACATATGGGTTGATGACCTCCAAAGAAAGTGGTCGCGGA
GCTCATGAGTGATGACCTCCAAAGATGCTTTTTACACGTGGACAGCAGAG
ACAGAGACAGAGACAGAGAGGAAGGTGCAGTGGAAAGCACAAGCAAAGCA
AAGTAAAAGAGCAAAGCAGAAAGCATGGCTACCCTTTCAACATGAGATTT
GCGGTGGAAAAGAGCAAAGCAGAAAATATGGCTACCCACTGAGATAATTA
CAAAAGAAAAGTAGAAAAGAAAGAGAAAAACAAAAGTAAGGAATAAACAT
TCTACCAGAATGATGTAATTTATTATCTTTCGGAGACATATGTATAAACC
CCATCCGAGGGTAATATGTATAAACCCCATCAGAGGGTAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAGAACAACGACAAGCCCAAAATAAAT
GGGTTGGACTGGAATGTTGTGGAGGGCGAAGGCCCATAAGCCCAAAATCG
CTCCAATCAAGCTATCAAAAGTACGCCCAGTACTTCAAATCATACATGAG
CACTACTCATGTCATTCATACATAAACATTCATGAACATCACTCATGACA
ATCATACATAAACATTCATGACCATCATTCATGTCAACATTCATGAGCAT
CACTCATGCTAACATTCATGAGCATCACTCATGTCAATCAACATAAACAT
TCATGAGAATCACTCATGTCAATCAGCTTCAAAAGCTTAATTTACAGAGC
TTTAGCTTCAAAAGCTTAATTTACAGAGCTTTAGCTTCAAAAGCTTAATT
TACAGAGCTCTAGCTTCAAAGCTTCACTTGCAAAGCTTCACCTACAAAGC
TTCAGTGCAGGGTATACAAATACCGCCTCCGAACAACCACCACTTCGGCC
CATACATGGATTCAATTTGAAGTCTCCAGCCAACAGACTCTATTGACCGA
AGACTTGGGGGACTACATTATGTACCATATATTGGGCCTCAACTGGGCCT
CATGAAAAATACTTGGGGGACTCTAGCCCATTATTCATGTACTGAGGAGT
GAACCCTTATTCTATAAAAGGGACTCCCTCACCTTCAAACGCCACAAGCC
AAGCCAACCAAGGCAACATAAGCTACAAGCAAAACGGCCTCACAACATGT
GCTACTTCTAGTTAAGCATCATTTCAGATTGGGCACCGCCTCATATCGAG
CATCAGTTACTTCGGCCCACACATGGACTGAATTTCAAGTCTCCAGCCAA
AAGACTCTCTTGACTGAAGACTTGGGGGACTACTGTTTATACCATATTTA
GGGCCTCGTATATTTGGGCCTTGGGCCTTGTATTTGGGCCTCACACTAAA
GCCCATACTTTGTAAARGAGGAKGAGCCCCTTATTCTATAAAAGGGGACT
CCTMCCCTCATKCTAGGAGAGGCTCAYTCTCACYMTCRGAGGCCAWTTCY
KAAGCCTCTCACCCCCTCTCAAAGCTTCCTCACACCCCCTAAGCTCTAAG
CTCTCTCTCTCCCTCTTCAACAGAGAAATATAATACAATCAGTGTGGACG
TAGCCCAAACCTTGGGGTGAACCACGATAAAATCCTTGTGTTCTTTGTGT
TCTTCGTGTTCTTGAGCGTTTGTGCAGATTCACGGCCGGATTTACGTTGT
ACCAAGACCATCCGGTTTTGTGCATCAACATGGTATATGCTTATCTATAA
ATTCAATTAATTATTAGCTATACTAGTATGCTTTTCCTTTTTAATATAAG
GAGAGGACATAGGAAGTAGATATTGCATCCTCTTATCTCCAATGGGAATA
CCTATTTAGGGACTCCACCATCACCTTTGAGTACGCATTTAAGGACCTAA
AGAGAATCTTTGTGTCCCTAAAGGAATATTGCCTCCAATAGGAGAGTCCT
TATAGTAGATCCCTAAATTTGAAGTTTTTATAATTTTATATGATAATTTG
ATTAGGTGCACATTTTTGTTTATTAACTTTTTTTAATTAATTTAACATAA
CGTTTGTAACATCCCACATCGCTTAGGGGAGTCATCCTTAAATGTATATT
CCCATCCCTACCTAGCACGAGGCCTTTTGGGAGCTCACTGGTTTCGGGTT
CCATAGGAACTCTAAAGTTAAGCGAGAAGGAGGTCAGAGCACTCCCAGGA
TCGGTGACCCACTGGGAAGTTGCTCATGAGTTCTCAAAAACAAAACYGTG
AGGGAATGGTAAGCCCAAAGCGGACAATATCRTGCTACGGTGGTGGAACG
GGCCTGGCATGTGGTGGACCAGGGCCGGGATGTGACAACGTTGTTGTAAA
ATATTTTTGTGAGCATTTTAACAAAAAAAAAAATTGAAATTCTAACACCC
AATCTTTTTTTTTTTTTTTATRATATGTAATCAACGCCTTTAAAACTAGA
CTCGTATAGAAAGTATCAGCCAACATCTTCTTCAACTCTATCTTTTTCTC
AAAACATTATCTGAATTCACTTATTTATTTAGCTACTTCGCTACCTTCGT
ACACCAACTTCTCATTTGTTTAGCTACATAAGTATTCGTTTGTTTTTTTT
TTCCTCAAACATTCAGTTATTATTCATGTATGCTTGCTTGTGGAAATTGC
ACAATTTTTCTTTAATTGCCTCTTGAATAAGGTCACAGGTTTGTTGTCTC
CTACTTGGTGTCTCTTTTGTGTCTCCATTATAATTTTTTAACACCTGTCC
CTCTATTTAACCTCATATCTAACACTGTTAAACTTTCAATTAAGTTTAAT
TAAAAAATAAAAATTGAAGTTAAACAAAAAAAACCGAAAACCCAACAGCA
ACCCTTCCCAACCAATAGTGTCTCGCAGCCACCAACCCCCAATCTCCTCC
CCATCATGCTTGTCAGCTGCATTTTCTAACCATTGGCAAGGTTTCCTTTG
TTGGGGATGTAGGATCTAATTGTAGTCCAAGCATTCTTTCTTTGTATTTA
TCACTCTTCCTCTCTCTCGTCGACGAAGCCGAATCGGATCTTAGAGTCAG
CTCTGCGTCGGTTAAATCTCGTCGTTTGTTCAATCCTTGCAGATTTCACC
ATCTAATTTAACAATACTACGGGAAAAAAAGGTGAGACAAAGTTAAGCAA
AACTTTAACAACTATTTGTATATCCTTCAAAACCATTCTCAGATCAAGAG
CTTTGAACATTTTTATAATCCAATGTGAATCTCAAGATTAAAGAAGCTAT
ATATGTGCTGCAAAGAATCATCTCAACTATCCACCAATACCAAGATGTAA
TTTTGRAAACTAGAAATCATAACAAACCGTATAAACAAGTTTCAATTCAC
ACAACTCCACCAAAGTTACCAAAATTATTCCCTAACCCAAAATTCAATTC
CACTTATCAACTAAAATCAACTTTCCTCTAACAAAATCACTTCTTCAAAA
GTGCGACCAAACAAGAAATCACAATAAACTCAAGCTCATTTCTACAAATC
AAAGCATCAAATTTCATTAAAAAAATACAACAATTTGCAGAATTTAAGCC
AAACATAAAAAGAAGATGAAGAAAAAAAAGAGTCATAAAGATCCTGAGAA
GCAAAAACCACAGAAAATGGAAGATGGGTTTTACTTGTGCGGATGTTCAT
GTTCCAGGTCGCTGGCGGAGTACGAGAAGATGGGGGAGGCRAGAGAGGTT
TCCTCATGAAGAAAAAAAAAAGAGTCATAAAGATTCTGAGAAGCAAAAAC
TAGGAAAAAAATTAAAGATGGGCTTTACATGTGCCRTTGTTCATGGTTCA
GGTCACTGGTGGGGTACGAGAAGGTGGGGGAGGAGGCAAGAGAGGTTTCC
TTTCTCTCTCTCTCTCTCCTTTCTRTTTCTCTCTCTATAAAATCAGAAAT
GAGGGTTGCAATTTTCTAAGTAACCCATTTATAGGGGTGGAAAAAATTGC
CGAAAATCCCAAACCGAACCGAAAAAATCCTGATCCCAAACCAAAAATTT
CCCAAACCGAAATTCTTGAAATTCTCGGATGCTATCCTAAACCGATCCCA
AAATTTCGGCATGGGATTCAGGATTGGCTTCTCGATATTTCAGGAATCCT
ATACTGAACCGAAAATATATAGTATTAATTATTATATATATATTTATACA
TATATATTATATATATTATTCTTTTATAATTGATGCTAGTAGTTTCTAAT
TCATGCTCTGCAACCTAGAATGCCCTACACCTTGCATATTTTTCATGTTC
TGTTTTATATTCATTTGGATTTTATTATTGCTGCTGTCATGATTGATGAT
TTTAGAAGGCGTGATTCCTTTGTCGCTCAACAGATTGCCAAAAGGGGTTT
AATTAATTTAAATTTTGCCTCTAATAAAAACAGTCAGGCATGCTAGTGTT
CGATTAAATGGTAGTGTGAATTAAATGACATTCCTAGTTCATGAATGTGT
TCTTGAATTATATATTTGAAGAATAATGCATAATTTCATATTTTAATTTG
GGATTCCCAATGACACACCTCGACCGAGATCAAGGTATGATGGCCGTCAC
GTGAGAGTGACATAGCCATGTGCATAGTGCGGAAGCAATAAAGATAAGAA
TTATACGAATAATTAAAAACCGAATTACTAGAGTGCACTACTAAATAGGA
AGTGATAGGAGTTAGTTACAACAGTAAACACTCCTAAGCAGAGCATATTA
AGTCTATGTGCAGTCCAGTAGAACAAGTACTAATTATACAGTACCAGGAA
TGTCCTACTATTATTTAGATAGGTCAGAACCGCCGACGTCCTCAAGCCAC
CAACAACAAGCTTACTTAAAACCTGGAGGGGTGCAAAATAGAAAACGTGA
GTGGGCAAAAACAAATGTTTTACAAAATCATTTTCTTTATCAACATATTT
AATCCCTCGCTGTAAAACATGTATAATTTTTCCCAGAATCAAGATATAAG
CATATACATAATATATATCTGAAATCATAACAATTAATTCATGCTTCACA
TAATCATATTCATATGTATGCCATGCCAAAATATAACAAAGTAAACAATC
CAGGTAAGAATGATTTCATAGAAATATGATACGTTAGCCGGAACCCCTGT
GGTAGTCTGTATGACTGAATTCATAGCTCAAAAGTCAATCTAGCCGGAGT
CACTACAATGACCTATATGGCAATATACTGCACATAAGTCAGAACCACTA
AAAATGGGTCTGTACGACAAGATTGGGTGTAATATAATTATGCTTAATTC
TATTCTCTCATAATAGCCAGGCGATAAATCGCTAGTCACCTACGAGTCAG
AACCATAAATAAGGTTTGTACGACAAGACTGTGCACTTAAGTTGGATCCA
ATATGAGCATAYAGTGCGGGAGGTGACATAAATAAATAGGCATGTACTTC
ATATTTCTGGCTAAATCACAATCACCCTAGGTGCAGTTTTATGAGCTCAA
CATCATTTCACATATCAAATCATCAATGAGTCACAGAACCAAACATAACT
TACCTGGACTTACATGTGCCTCCACAACACCACATTTATATCTATGCAAC
TATGAAATGCATATTCAGAATAGAAAAGCATTTGGCATATTATTTCAAAG
CATACTTTCTTTAAAAATGCATTTCTGGGAAATATATCAAGTATATAAAT
ATATACTGAAAACAAAAGCCCACTCACTGGTATGTCGACGGGTCATAACC
CCCGAGTCACCCGTGGATACGCTCGTCCTCAGGATAAGTCTCACCTATAT
GTGAATTAACTATAAAAACGTTATTTTAAAGCACATGGCAAAACTAGCTA
ATAACTTCTCATACAAAGCTCAAAATGGGTATATGAATATACCACAGTGA
CCTACACAACCTCAGGATCATCCCCAAATTTTTAGAAATTTTTTTGGAAG
CCTCACGCGCCCCCACGCGCCGGCAATGGCACGGCTAGACGCGCCCCCCA
TGCGCGGCCATGTGCCAGGCACACTGACGGTGTCAATTGACGTTGTCAGG
TATATTCCGGGAATATTMTGTTATTCCTTAACAAAACTTAACGGCGTGAC
CTAGTGCCGTTAGAATATTCCGTTAAACTTAACGGAATATCCTCTCGTCT
TCTACCTTCAGCTYTGACGACCGTCACCGTCGTCGGAAAACTGGGAAATT
TTCAAAACTCTATAACTCATTCATTTTTCATCCATTTTTCACGTAATTTA
TACCAAAATGAAGCTCTTAACTTGTAGAACACAATCATACTAATTTAAAG
CTCTAAAAGTCACGGAATCTCACCGGAGAATTCCAAGAAAAACCTGCCAA
ACTTCGTCCACACGATCCCGACATCCAAAACCTTCAAACGAAGCACTCCG
AGCTTCCTTGGGAYCTCACTAAGCTTCCTACAAGCTTCAAATTTCCAAAA
ACATCCATAATTACGTGTGMATGAACAGTGCACAAATCGAGGATATGAAA
AACTAGGGTTTTCGAAGGTATCTTTACCTGAAATGGGTACCAATCAACTC
GTGACCACGATCCGTGAAGTTTCAAGGGCTTTGGGTGTTTGTTCGTACGA
GTTCGAAGGAGAGAGAGAGTGAGAGTCCGAGAGAGATGAGAGGGTACGGG
AGAGAGAAGAGAGAATGTGTGTGTGTGTGGCCTAGGATTGGTCAACCACC
AAAAATACAATAACTTAGTCCTAATTGGTTCCAAACAATTAGGATTTAAG
AATATTGACCCAAAAYCACACTTAAACCACATTACACAACTAACGTCCAA
GGGTATTTTYGTCAATTCACGCCGTCGATAAATATATATTTGGGACGGGC
TGTGGCACCCGATTTGTCCCAAATTCTCGAAAATATTTTGGGATTCCCRA
AAATTTGGTTTGGGTTGGTCTTCAAATTCCAGTCCCAAAAAATTTCGGTT
TRGGATTCGAGTTACTAGTTTCGGTTCGGTATYCCATACCGAACCATCCC
TACCCATTTATATGGGAGAACAATTAGGTCATTTCAAGGTGTAGAAAATA
GCGTATGCATTCTYTGTGCATAACAAAAAAAAATCCTATTTATRTTTCAA
GATTAAAAAATTATCCCATTTTAAGGTATTTTCTAGAGAAAATAAGCACC
AAACGGTGACTTAGCCGCGCAACAAACCCCATACAGAGCTTTGTAAGCAG
TCGTGCGAAGGCAAAGGACGAGAGATTCTTTTGTCTGATGCCTTACCTAG
TTGTGTCTTGCTTGCAAAGAACCAGAGGGAGTAATTTGTAAAAGAAGGTA
AGTTTGGCTCCTACAGAAAAAAAATTCAGCAAATCAAGGGGCAAAAAGGA
AAAGAAAAGAWAAACTTTTCGAGATCCGTGCCAAAAGTTCATCTTTTCAC
CATCAGTGTGAGAGTAGGGAGAGTTTATTCTCTCAAGCTCGGCCGCCTTT
ACACCATCAATGGCGGAGTACGAGAGGCATCAGCTGCAGCAACAGTCAGG
CGGTGGCGGCGGCGGCGGAATCCCCAAAGAGAGAGCTGTGCAAGCCATAA
ACACAATCATACAGCTCCACTTCGAGAAAACCCTCGAGAAGAAGAGGTCC
ATCGACCTCCAGAAGAAGGAGCTCCACAAGCTCTTCATCCTCTTCTTCAT
CTTCCTCGCCCTCGTCTTCTCCGCCCAGTCCTCTGCCTCCTCACGCCTCC
AGTGCCGCCACTGCTGGGTCCCAATCATCCTTCTCTCCCTGGCCCACCTC
ATCTTCTACGTCTCGGTGGCGCAGACGCTCCGGTGCATCAACGGGTTCAA
GTACCAGCGGCGCTGCCACAAGCTGACGCTGGGACTCGCCACCGAGAAGC
TGAGGGAGATGAAGGTGAGGCTGAGCGATGAATTCGATGCCCCGATTTCC
GACGAGGAATTTGAGATTCACTACCAGGAGCCTCCGGAGGCCTACTTTGC
GAAGTTCAAGAGGAACTGGGCTTGCCATTTTGCCTTCTTGATCCTCATCT
ACTGCTTCATGGTCTCTTCCTCTGTTGTTCTCCTCTGTTTTTAGTTACAT
TCTTTTTGCCTTTTTGTTTAAGTTAGTTGAGATCTGCTTCAGCCACTGCA
TACTGGTTGAACTCGCAGCTTGGAACAAATATCGCTTGTAATTTAAAAAT
TTCGAGGGATATAAAGTTTAGAATCCAAATTTTATTCCTCTCCTTTTCTT
ATATTTTGGATGTACCAAGTTTCTGTCCTGGAAAATTGAAATATCWCTCT
CTTTCCTTTTGAGATTTTGACAGGAGCGATCAATTTATTAATCTYTATTA
ATGAAATTATTATCTCTTTCCTTTTGAGTATTTGATTGATATATCGCCAG
TGCTTGATTTTGATTAGTTTAGCAATTAAAATTTATAAAAATAATTATTT
CAGTYGATTTTTCKCTTTTCTTTGACAGCATAATGAACATTCTCTYACAT
GGTCAAATTCTTATTTGTGTTTCCAACTAAAAATCTAACGGTTAAAAAAT
TCAGAATATACTTTCTAGCATCATAGAAAATCCGTTGTTTGAATTGGAAT
TTGTATTTGAAAAGGATGATAAACCCACCCAAGTGAACATTCGACAGACA
TAATAATGACTGGGTGCTGAGATTTCTAGTGAAACTTCTTGAGATTGTCC
TTTTTTGCTTTCTTTCTAAATTTGTCAATAGATTCAACACAATTCCACTT
GATGCACATTTCGAATCGTGAATGCACACAACCGGAACCTTCTGAGCTGA
GGCCGTGGCTTAGGCCGGGGATAATGCATTGCACAGAGATTTGTAGGCAT
TAAGACAAAGTTTAAATTTCTCTTCGGCGATTTCCTGCAAAGATACACGA
CTATCTTACAAGTATATAACAATGAAACAGAAATTGTAGAGCTCTTATGT
AATGCTAATATGACGAGCAAGAAACTAGAGCACACAGCAGAGAAACAACC
GCAAGTTAAGCAGAGGGTGCAGCAAAACAATCACAGCGGCAGCATTAAAA
CCCGCTCAAATAAATGAGAGTTCGTCAATTTCATTTTCTTTGTGGCATTG
TGATTGCTCATAAGATACTGTCAAATTCATATTATGCACTGAAGAATGAA
GATCTATACTTATACAGTGGACTAAAACAAAAATTANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNAGACCGAGAATTGTTCTATCAGAAAATGATCCGA
TAGTACGTGATTTGTCATCAGATTCTGTGTCACTACTATTCTCCCATCTT
TTACTTCTACTTTTCCAGCTCGATTGCTCTCTCCACTCAAATCCAGATTC
TGAATCTTGGTAAGAAGAGTCACGTTGTGAGTTAAAAGACCAGGTGTACC
ATTTCTTTCCAAATGTCGCCCGAAAGATTTTCTCAGGATCATTGTCATAG
TCTTCAGAGAAACTCTCTCTTTTAAACTTCCCTGAACAAGTAACAGAGAG
AACCATAAAGTTTGTAGGATAAAGTAATGCAAACAAATCATAACCTTTTT
TAACCACCTACCAGAAAAAGAACGGCCGRGGTTTAAAAAATCTACTGCTT
TCACCATAAGATTAGTAGTAAAAAGACTTAAATGAGCCATGTGGCAGTCC
ATTTCTTCCGACTTTTGTATCCCTCTTATCTGATTTGGACACCTAAGTAC
CTCTTAAGGTACAAAYTCCYGCTTGAATCGTACACATGGTTGGGTGAATA
CCTCTGATTTGATTAAAACATRTGACCCACAGTTTGTCTTTCTCCCCTGT
TAAAAGTTAGACATCCAACCCCACACAAGTTTTAGAGTACCCGATGTAAG
ATCTTATATTCTCAATAGGCCCCCTCAAATGTGACCAGACTGAGCCAAAC
ACACAAGTCAATTATATTGAGCAATGTGGAGCATGTGTGACCRAGCTAGG
TCTAACACGTGAATAAATCTACTGCTTTGACACCATGTTCAAGAGAAACA
CTAAGAAAAAAGACTAGATCATTGTACTGCATTCTTAAAATGACAATACA
TGAATTTAGTGCATCATACAATGATCATGCTGCATTTCAGCACATCTATC
AACCACCCATCAAGCAAATGGGATGAGAATAACAAGAATATCAGTATTTC
AACCTGAGATTATTTGTGCAATAACCTACTCTTTCTTATCTTCCAATCCA
CCAGGATGGAATGGAAGGTAGCTGGAGTTAGTATGTAATTAGCTTCAGGT
TTAAATTTGTAGGTGAAACAATTTAGCTCTTATAGCTAAGTTTTCTTTCT
GTTGAGGTTGAATATTTGYCCACAATTTTGTGGGAAAGAGTCCATAGTAT
AGTAATATAAGGGACCTRAAAAATTACATATAACATACATCCATGTAGTA
TTCAAATTATTATATTCAAAATTTCATTKTTTTAATACAGAGCTGCATAA
TGTGCTTATAATATGTTTGTTTAACCMAAAAAAAAAAAMCMAGCATATTT
TTCTGTACAATTGAGAAGTTCATGCGAAACAGGAGTAATTATCAAAAGCA
TGTATCCTATTCACATGTTTACCAAGAAGCAATGACTCTAATTAAGTGCA
AAACCTATACACATGTTCAATAGGAAACCACATCAGGGCTTCCTRCAGCC
ATACATGCACTTTGAGTTAAGACTTCGTGTCCGGTTGTGGGAAGAAAGAC
TTCATCAAATAAAATTCATTAGAGTTAAGACCTCRTGTCCAGATGTCGGA
ATTAAGACTCCATCAAATAAAATTGCGTAGAGTTCAGACATCGTGTCCAG
TTGTGGAAAAGATACCCACCATCCAGATAAGAGTACACAAAATGTCTCTA
TCACCAAAAAAACCTACTTGTTGAAATGAGGATGAGTAGATCGGCATATG
ATATAGCTCAGATGCAGGTGAAAAATCACACACAATAAATTACAGATCAT
TAGACAAAAATTGAATACATAAACAAATTATCAGATATAGAAAACATGGG
ATAGAAAGGTTTAGATACGAAACAATAAGAAAAGCTCACTTTTCATTTTC
TTTTGTTGCGATTTCTCAGCATGTCGAGAAGATCTTGATCTATGTTTCTT
AGGAGAGCTACCCGAAAAATCTTCATTCTAATTAACATTGAAAACAAACC
ACAATATCAATACATGGAAAAATTGATACAGTTTTTTTTTTTTTTAACCA
TAAGTAGATACATTCATAATAAATCAGGGAAGCACTATAGGTAAACTGGA
AGACAAACTGAGTAGGCTCGTTTGGAATAATTCTAAACTCTGAAAGTTCA
TGGGGGAATCTGTCCTTTGGTGGTTTACAAATCATCTGGATTAACAATTA
AGGATCCACAAGACCATTAAAATACTTAGAACTATCTCATGATTGGCAGC
AAAGGATAAATTTTAGGCTCCAACAACATCAATTATGATCTTTTCATCAC
TCTTTTTGAAAATTTCTTTTTCTAAGGAGTCGATTTAAATTATGTGTAGC
TATATCCAAAACAAAGTTGAATTCAAGGACATTCGATCAGAACTTAATGT
CCAAAGTAT
back to top