GDsnp01295, GDsnp01295 (genetic_marker) Malus domestica

Marker Overview
NameGDsnp01295
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
SpeciesMalus x domestica
Publication[view all]
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GDsnp01295GDsnp01295Malus x domesticamarker_locus


Sequence
>GDsnp01295 ID=GDsnp01295|Name=GDsnp01295|organism=Malus x domestica|type=genetic_marker|length=201bp
GGTGAGTGATTTCTTCCGCAAATTCTGAATTTTTCTTGGATGATCGGGGT
GTACGCTCGTATGTGGAAATAATAACTGTATATGGCATCTTCTATATGCT
RTTCTCATAGTAGGCGTTGTTTTTTTATATATTTCAGAATTTGAACGGAC
ACAGAAGGAACAACCCTTGCAACTCCCTCCAAAGCCTCCCCAGAAGAGAA
A
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map1N/A59.8GDsnp01295View
2Apple-FjxPL-F1-2013LG1N/A56.65GDsnp01295View