|
|
Marker Overview
| Name | BPPCT-037 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Prunus persica |
|---|
| Primer 1 | BPPCT-037.F primer: CATGGAAGAGGATCAAGTGC |
|---|
| Primer 2 | BPPCT-037.R primer: CTTGAAGGTAGTGCCAAAGC |
|---|
| Publication | [view all] |
|---|
Publications
| Year | Publication |
|---|
| 2007 | Dondini L, Lain O, Geuna F, Banfi R, Gaiotti F, Tartarini S, Bassi D, Testolin R. Development of a new SSR-based linkage map in apricot and analysis of synteny with existing Prunus maps. Tree Genetics and Genomes. 2007; 3(3):239–249. |
| 2002 | Dirlewanger E, Cosson P, Tavaud M, Aranzana M, Poizat C, Zanetto A, Arus P, Laigret F. Development of microsatellite markers in peach [Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry (Prunus avium L.). Theoretical and applied genetics. 2002 July; 105(1):127-138. |
Alignments
| Feature Name | Type | Location | Analysis |
|---|
| Pp05 |
chromosome |
Pp05:12306819..12306963. |
Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1) |
|
