RW18N19 (genetic_marker) Rosa sp. | GDR

Marker Overview

Marker Overview


Name	RW18N19
Genbank ID	N/A
Type	SSR
Species	Rosa wichuraiana
Repeat Motif	(CTT)6
Primer 1	RW18N19.Forward: CCCGAGAAAGAGACAGTAAA
Primer 2	RW18N19.Reverse: ATCGAGAGAGACACCGACTC
Product Length	250
Publication	[view all]
Contact	Dani Zamir Oron Gar Johan Van Huylenbroeck L. Leus David Byrne

Contact

Name

Details

Dani Zamir

First name:	Dani
Last name:	Zamir
Institution:	The Hebrew university of Jerusalem
Address:	The Robert H. Smith Institute of Plant Sciences and Genetics in Agriculture, The Hebrew university of Jerusalem, P.O 12, Rehovot 76100, Israel.
Email:	zamir@agri.huji.ac.il
Phone:	972-8-9489250/092

Oron Gar

First name:	Oron
Last name:	Gar
Institution:	The Hebrew university of Jerusalem
Address:	The Robert H. Smith Institute of Plant Sciences and Genetics in Agriculture, The Hebrew university of Jerusalem, P.O 12, Rehovot 76100, Israel.

Johan Van Huylenbroeck

First name:	Johan
Last name:	Van Huylenbroeck
Institution:	Applied Genetics and Breeding, Plant Sciences Unit, Institute for Agricultural and Fisheries Research (ILVO)
Address:	Caritasstraat 21, 9090 Melle, Belgium
Country:	Belgium
Email:	johan.vanhuylenbroeck@ilvo.vlaanderen.be

L. Leus

First name:	L.
Last name:	Leus
Institution:	Applied Genetics and Breeding, Plant Sciences Unit, Institute for Agricultural and Fisheries Research (ILVO)
Address:	Caritasstraat 21, 9090 Melle, Belgium
Email:	leen.leus@ilvo.vlaanderen.be

David Byrne

Description:	Rosa and Prunus Breeding and Genetics
First name:	David
Last name:	Byrne
Title:	Professor
Institution:	Texas A&M University
Address:	Department of Horticultural Sciences, Texas A&M University, College Station, TX 77843-2133
Country:	USA
Email:	dbyrne@tamu.edu
Phone:	979-845-9500
Keywords:	genetics
Last update:	Feb 2006

Publications


Year	Publication
2011	Gar O, Sargent DJ, Tsai CJ, Pleban T, Shalev G, Byrne DH, Zamir D. An autotetraploid linkage map of rose (Rosa hybrida) validated using the strawberry (Fragaria vesca) genome sequence. PloS one. 2011; 6(5):e20463.
2010	Moghaddam HH, Leus L, Van Huylenbroeck J, Van Bockstaele E, Riek JD. Pathotype dependent resistance mapping for powdery mildew in a diploid rose population. Acta Hort. 2010. 870: 103-107
2012	Moghaddam HH, Leus L, De Riek J, Van Huylenbroeck J, Van Bockstaele E. Euphytica. 2012. 184:413–427
2006	Zhang L.H., Byrne D.H., Ballard R.E., Rajapakse S.. Microsatellite marker development in rose and its application in tetraploid mapping. Journal of the American Society for Horticultural Science. 2006; 131(3):380-387.
2008	Hibrand-Saint Oyant L, Crespel L, Rajapakse S, Zhang L, Foucher F. Genetic linkage maps of rose constructed with new microsatellite markers and locating QTL controlling flowering traits. Tree genetics & genomes. 2008; 4(1):11-23.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Rose-YRW-F1-integrated	int.6	N/A	40.2	Rw18N19	View
2	Rose-YRW-F1-R.wichurana	B6	N/A	26.6	Rw18N19	View
3	Rose-82-1134-F2	LG06	N/A	6.2	RW18N19	View
4	Rose-86-7-F2	LG03	N/A	39	RW18N19	View