eppisf018 (genetic_marker) Prunus persica | GDR

Marker Overview

Marker Overview


Name	eppisf018
Genbank ID	DN676935
Type	SSR
Species	Prunus persica
Repeat Motif	(TCT)5(TCC)3
PCR Condition	56
Primer 1	eppisf018.Forward: TTGGATGAAATTGAAATCGAAA
Primer 2	eppisf018.Reverse: GTGATCTTGGACAGCGAAGC
Max Length	290
Publication	[view all]
Contact	Ignazio Verde

Contact

Name

Details

Ignazio Verde

First name:	Ignazio
Last name:	Verde
Title:	researcher
Institution:	Istituto Sperimentale per la Frutticoltura (CRA)
Address:	Via di Fioranello 52, Ciampino Aeroporto, 00040 Rome, Italy
Country:	Italy
Email:	ignazio.verde@entecra.it
Phone:	(+39) 0679348183
Fax:	(+39) 0679341630
Keywords:	Peach

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Pp02	chromosome	Pp02:5464316..5464544 .	Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)	GDR marker alignment to genome using primer sequences

Publications


Year	Publication
2007	VENDRAMIN E, DETTORI M, GIOVINAZZI J, MICALI S, QUARTA R, VERDE I. A set of EST-SSRs isolated from peach fruit transcriptome and their transportability across Prunus species. Molecular ecology notes. 2007; 7(2):307-310.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Peach-CF-F2-2014	2	N/A	13.16	eppisf018	View
2	Peach-CF-F2	G2	N/A	10.7	eppisf018	View