|
|
Marker Overview
| Name | Rubus228a |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Rubus idaeus |
|---|
| Germplasm | Glen Moy |
|---|
| Source Type | Genomic Clone |
|---|
| Repeat Motif | (ga)41 |
|---|
| PCR Condition | Ta=59°C |
|---|
| Primer 1 | Rubus228a_F: TGGACAGCTTTGTGCAGAGT |
|---|
| Primer 2 | Rubus228a_R: GCTTGCTTGTATCTCCATTGC |
|---|
| Product Length | 150 |
|---|
| Max Length | 150 |
|---|
| Publication | [view all] |
|---|
| Contact | Bryon Sosinski
J. Graham
|
|---|
Publications
| Year | Publication |
|---|
| 2004 | Graham J, Smith K, MacKenzie K, Jorgenson L, Hackett C, Powell W. The construction of a genetic linkage map of red raspberry (Rubus idaeus subsp. idaeus) based on AFLPs, genomic-SSR and EST-SSR markers. Theoretical and Applied Genetics. 2004 Aug; 109(4):740-749. |
| 2014 | Molina-Bravo R, Fernandez GE, Sosinski BR. Quantitative trait locus analysis of tolerance to temperature fluctuations in winter, fruit characteristics, flower color, and prickle-free canes in raspberry. Molecular Breeding 2014 33(2):267-280 |
|
