CN908484, CN908484 (genetic_marker) Malus x domestica | GDR

Marker Overview

Marker Overview


Name	CN908484
Genbank ID	N/A
Type	SSR
Species	Malus x domestica
Repeat Motif	(AG)12
Primer 1	CN908484.forward primer: CAGGCGCCATTTTTAGAGAG
Primer 2	CN908484.reverse primer: GGAGTGGCGAATTAGCTGAG
Max Length	275
Publication	[view all]
Contact	Schuyler Korban

Contact

Name

Details

Schuyler Korban

First name:	Schuyler
Last name:	Korban
Title:	Researcher
Institution:	University of Illinois
Address:	Urbana, IL 61801, USA
Country:	USA
Email:	korban@illinois.edu

Publications


Year	Publication
2012	Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2009	Gasic K, Han Y, Kertbundit S, Shulaev V, Iezzoni AF, Stover EW, Bell RL, Wisniewski ME, Korban SS. Characteristics and transferability of new apple EST-derived SSRs to other Rosaceae species. Molecular Breeding. 2009; 23(3):397-411.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Apple-C16xC17-F1-2012	15	N/A	36.19	CN908484	View
2	Apple-MM-F1	15	N/A	33.5	CN908484	View
3	Apple-M432-2012	LG15	N/A	38.8	CN908484	View

Alignments

Feature Name	Type	Location	Analysis
Chr15	chromosome	Chr15:9426695..9426843.	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr15A	chromosome	chr15A:9527106..9527254.	Malus x domestica ‘Honeycrisp’ Genome v1.1.a1 Assembly & Annotation