CN913979, CN913979 (genetic_marker) Malus x domestica

Marker Overview
NameCN913979
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat Motif(TC)14
Primer 1CN913979.forward primer: CAGCCTTCTGTTCCTCTCTCTC
Primer 2CN913979.reverse primer: GAAATCGATTAGGCGATGGA
Max Length160
Publication[view all]
ContactFelicidad Fernandez-Fernandez
Schuyler Korban
Contact
NameDetails
Felicidad Fernandez-Fernandez
First name:Felicidad
Last name:Fernandez-Fernandez
Title:Researcher
Institution:East Malling Research
Address:East Malling Research (EMR), New Road, East Malling, Kent ME19 6BJ, UK
Country:United Kingdoms
Email:felicidad.fernandez@emr.ac.uk
Fax:+44 1732 849067
Last update:Mar 2006
Schuyler Korban
First name:Schuyler
Last name:Korban
Title:Researcher
Institution:University of Illinois
Address:Urbana, IL 61801, USA
Country:USA
Email:korban@illinois.edu
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerCN913979.forward primerMalus x domesticaprimer
reverse primerCN913979.reverse primerMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CN913979CN913979Malus x domesticamarker_locus
CN913979.yCN913979.yMalus x domesticamarker_locus
CN913979.zCN913979.zMalus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-C16xC17-F1-201210N/A70.03CN913979View
2Apple-MM-F110N/A29.8CN913979.yView
3Apple-M432-2012LG10N/A29.2CN913979.yView
4Apple-M432-2012LG15N/A31.5CN913979.zView