|
|
Marker Overview
| Name | CH04f08 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Malus x domestica |
|---|
| Repeat Motif | GA |
|---|
| PCR Condition | annealing temp 60 degree |
|---|
| Primer 1 | CH04f08.forward: ATTTGAGATTGGGGGTGGAC |
|---|
| Primer 2 | CH04f08.primer 1: ATTTGAGATTGGGGGTGGAC |
|---|
| Primer 3 | CH04f08.primer 2: ATTTCCCCGATTTAACCGTC |
|---|
| Primer 4 | CH04f08.reverse: ATTTCCCCGATTTAACCGTC |
|---|
| Product Length | 180-200 |
|---|
| Polymorphism | P_ CH04f08 |
|---|
| Publication | [view all] |
|---|
| Contact | C. Gessler
Riccardo Velasco
|
|---|
Publications
| Year | Publication |
|---|
| 2002 | Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241. |
| 2012 | Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203. |
| 2015 | Cova V, Bandara NL, Liang W, Tartarini S, Patocchi A, Troggio M, Velasco R, Komjanc M. Fine mapping of the Rvi5 (Vm) apple scab resistance locus in the ‘Murray’ apple genotype. Molecular Breeding. 2015. 35: 200. |
|
