ARSFL027, ARSFL027 (genetic_marker) Fragaria ×ananassa | GDR

Marker Overview

Marker Overview


Name	ARSFL027
Genbank ID	N/A
Type	SSR
Species	Fragaria x ananassa
Repeat Motif	Direct
Primer 1	ARSFL027.Forward: gcgaagcccagactcaattacc
Primer 2	ARSFL027.Reverse (no gttt): gcgtacccgccattgttac
Publication	[view all]
Contact	Eric van de Weg

Contact

Name

Details

Eric van de Weg

First name:	Eric
Last name:	van de Weg
Title:	researcher
Institution:	Wageningen-UR Plant Breeding, Wageningen University and Research Centre
Address:	P.O. Box 16, 6700 AA Wageningen, The Netherlands
Country:	The Netherlands
Email:	eric.vandeweg@wur.nl
Keywords:	allo-octoploid strawberry

Publications


Year	Publication
2005	Lewers KS, Styan SMN, Hokanson SC, Bassil NV. Strawberry GenBank-derived and genomic simple sequence repeat (SSR) markers and their utility with strawberry, blackberry, and red and black raspberry. Journal of the American Society for Horticultural Science. 2005; 130(1):102-115.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Strawberry-HK-F1	LG3A	N/A	44	ARSFL027	View
2	Strawberry-HK-F1	LG3B	N/A	63.4	ARSFL027	View
3	Strawberry-HK-F1	LG3D	N/A	39	ARSFL027	View
4	Strawberry-HK-F1	LG3C_H	N/A	45.7	ARSFL027	View
5	Strawberry-HK-F1	LG3C_K	N/A	28.5	ARSFL027	View