|
Marker Overview
Name | DV439057 |
Genbank ID | N/A |
Type | EST-SSR |
Species | Fragaria vesca |
Repeat Motif | Direct |
Primer 1 | DV439057.Forward: CCTCCCACATGTACACGACA |
Primer 2 | DV439057.Reverse (no gttt): AGTTGAAACCTCTGCTCCGA |
Publication | [view all] |
Contact | Eric van de Weg
|
Publications
Year | Publication |
2013 | Isobe SN, Hirakawa H, Sato S, Maeda F, Ishikawa M, Mori T, Yamamoto Y, Shirasawa K, Kimura M, Fukami M, Hashizume F, Tsuji T, Sasamoto S, Kato M, Nanri K, Tsuruoka H, Minami C, Takahashi C, Wada T, Ono A, Kawashima K, Nakazaki N, Kishida Y, Kohara M, Nakayama S, Yamada M, Fujishiro T, Watanabe A, Tabata S. Construction of an integrated high density simple sequence repeat linkage map in cultivated strawberry (Fragaria × ananassa) and its applicability. DNA research : an international journal for rapid publication of reports on genes and genomes. 2013 Feb; 20(1):79-92. |
|