SNP_FB_1089798, SNP_FB_1089798 (genetic_marker) Malus x domestica

Marker Overview
NameSNP_FB_1089798
AliasF_1089798_L3_81_2
dbSNP ID.
SNP Array ID
480K SNP array for apple:SNP_FB_1089798
20K SNP array for apple:SNP_FB_1089798
TypeSNP
SNP AllelesA/G
Probe 1SNP_FB_1089798.probe: ATGAAAGCCCTCAATTTCTCACCATCAACATCATGGGGCACACTGTTAAC
5' Flanking SequenceAAATTTCTTAATGAAAGCCCTCAATTTCTCACCATCAACATCATGGGGCACACTGTTAAC
3' Flanking SequenceTAAACTTTCCTTGACCCAGAGTTCGATAGAGCAGAAGAAGAAGTCGTGGTGGTGGCAGTG
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Libraries
Library NameType
20K SNP array for appleSNP_chip
480K SNP array for appleSNP_chip
Relationships

The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeSNP_FB_1089798.probeMalus x domesticaprobe


Sequence
>SNP_FB_1089798 ID=SNP_FB_1089798|Name=SNP_FB_1089798|organism=Malus x domestica|type=genetic_marker|length=75bp
TTCTCACCATCAACATCATGGGGCACACTGTTAAC[A/G]TAAACTTTCC
TTGACCCAGAGTTCGATAGAGCAGA