SNP_FB_0812240, SNP_FB_0812240 (genetic_marker) Malus x domestica

Marker Overview
NameSNP_FB_0812240
dbSNP ID.
SNP Array ID
480K SNP array for apple:AX-115199351
20K SNP array for apple:SNP_FB_0812240
TypeSNP
SNP AllelesA/G
Probe 1SNP_FB_0812240.probe: TTGTATAAATAAGTGCCTAGTTATACTTAAAAAACACACATAATTGTTTC
5' Flanking SequenceTTCAATATGTTCTAATACTTTATAATNTANATGTCTTTTTATTTTGCAACTTATCTATCG
3' Flanking SequenceGAAACAATTATGTGTGTTTTTTAAGTATAACTAGGCACTTATTTATACAAAATATAATAA
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Associated WithGWAS0001371
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Libraries
Library NameType
20K SNP array for appleSNP_chip
480K SNP array for appleSNP_chip
Alignments
The following features are aligned
Feature Name Type LocationAnalysisReference
Chr04chromosomeChr04:12450137..12450137 -Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotationn/a
Sequence
>SNP_FB_0812240 ID=SNP_FB_0812240; Name=SNP_FB_0812240; organism=Malus x domestica; type=genetic_marker; length=70bp
ATGTCTTTTTATTTTGCAACTTATCTATCG[C/T]GAAACAATTATGTGT
GTTTTTTAAGTATAACTAGG
Annotated Terms
The following terms have been associated with this genetic_marker:
Vocabulary: Rosaceae Trait Ontology
TermDefinition
MAIN:000201215epicatechin content
28:procyanidin B1 contentprocyanidin B1 content
MAIN:000201221procyanidin B2 content
28:procyanidin B5 contentprocyanidin B5 content
28:procyanidin B7 contentprocyanidin B7 content
MAIN:000201216unknown procyanidin oligomer 1 content