|
|
Marker Overview
| Name | EMPaS10 |
|---|
| Genbank ID | AY526626 |
|---|
| Type | SSR |
|---|
| Species | Prunus avium |
|---|
| Source Type | genomic |
|---|
| Repeat Motif | (GA)28 |
|---|
| Primer 1 | EMPaS10.Forward primer: NED-gctaatatcaaatcccagctctc |
|---|
| Primer 2 | EMPaS10.Reverse primer: tgaagaagtatggcttctgtgg |
|---|
| Max Length | 183 |
|---|
| Publication | [view all] |
|---|
| Contact | Simon Vaughan
|
|---|
Publications
| Year | Publication |
|---|
| 2004 | Vaughan SP and Russel K. Characterization of novel microsatellites and development of multiplex PCR for large-scale population studies in wild cherry, Prunus avium. Molecular Ecology Notes 2004 4:429-431 |
| 2008 | Olmstead JW, Sebolt AM, Cabrera A, Sooriyapathirana SS, Hammar S, Iriarte G, Wang D, Chen CY, van der Knaap E, Iezzoni AF. Construction of an intra-specific sweet cherry (Prunus avium L.) genetic linkage map and synteny analysis with the Prunus reference map. Tree Genetics and Genomes. 2008; 4(4):897-910. |
|
