EMPaS14, EMPaS14 (genetic_marker) Prunus avium | GDR

Marker Overview

Marker Overview


Name	EMPaS14
Genbank ID	AY526630
Type	SSR
Species	Prunus avium
Source Type	genomic
Repeat Motif	(TC)10ccat(TC)5ccat(TC)8
Primer 1	EMPaS14.Forward primer: VIC-tccgccatatcacaatcaac
Primer 2	EMPaS14.Reverse primer: ttccacacaaaaaccaatcc
Max Length	196
Publication	[view all]
Contact	Simon Vaughan

Contact

Name

Details

Simon Vaughan

First name:	Simon
Last name:	Vaughan

Publications


Year	Publication
2004	Vaughan SP and Russel K. Characterization of novel microsatellites and development of multiplex PCR for large-scale population studies in wild cherry, Prunus avium. Molecular Ecology Notes 2004 4:429-431
2008	Olmstead JW, Sebolt AM, Cabrera A, Sooriyapathirana SS, Hammar S, Iriarte G, Wang D, Chen CY, van der Knaap E, Iezzoni AF. Construction of an intra-specific sweet cherry (Prunus avium L.) genetic linkage map and synteny analysis with the Prunus reference map. Tree Genetics and Genomes. 2008; 4(4):897-910.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Flowering Cherry-CYxE750-F1-CY	5	N/A	39.9	EMPaS14	View
2	Sweet Cherry-PAxPN-94	G5	N/A	45.9	EMPaS14	View
3	Sweet Cherry-47	G5	N/A	44.4	EMPaS14	View
4	Chokecherry-RCxSC-F1-2014	RC XI	N/A	39.2	EMpaS14-2	View
5	Chokecherry-RCxSC-F1-2014	SC XI	N/A	0.1	EMpaS14-2	View
6	Chokecherry-RCxSC-F1-2017	Cho-1	N/A	115.12	EMpaS14-2	View
7	Chokecherry-RCxSC-F1-2014	RC XI	N/A	48.3	EMpaS14-1	View
8	Chokecherry-RCxSC-F1-2017	Cho-1	N/A	97.22	EMpaS14-1	View

Alignments

Feature Name	Type	Location	Analysis
Pp05	chromosome	Pp05:15136554..15136728.	Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
PAV05_REGINA	chromosome	PAV05_REGINA:17400346..17400542.	Prunus avium Regina Genome v1.0 Assembly & Annotation
chr_5	chromosome	chr_5:31096389..31096585.	Prunus avium Tieton Genome v2.0 Assembly & Annotation
Pd05	chromosome	Pd05:14469994..14470190.	Prunus dulcis Lauranne Genome v1.0