|
|
Marker Overview
| Name | CN948094 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Malus x domestica |
|---|
| Repeat Motif | (AG)11 |
|---|
| Primer 1 | CN948094.forward primer: AAACACCCTTCATTCATCCG |
|---|
| Primer 2 | CN948094.reverse primer: TCGAGCTTGTTTCTCGGTCT |
|---|
| Max Length | 271 |
|---|
| Publication | [view all] |
|---|
| Contact | Schuyler Korban
|
|---|
Alignments
The following features are aligned
Publications
| Year | Publication |
|---|
| 2012 | Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203. |
| 2009 | Gasic K, Han Y, Kertbundit S, Shulaev V, Iezzoni AF, Stover EW, Bell RL, Wisniewski ME, Korban SS. Characteristics and transferability of new apple EST-derived SSRs to other Rosaceae species. Molecular Breeding. 2009; 23(3):397-411. |
|
