CN919347, CN919347 (genetic_marker) Malus x domestica | GDR

Marker Overview

Marker Overview


Name	CN919347
Genbank ID	N/A
Type	SSR
Species	Malus x domestica
Repeat Motif	(CCT)8
Primer 1	CN919347.forward primer: CCATCCTCAACTCAGTCCGT
Primer 2	CN919347.reverse primer: ACTGATATGGGTTTGGAGCG
Max Length	350
Publication	[view all]
Contact	Schuyler Korban

Contact

Name

Details

Schuyler Korban

First name:	Schuyler
Last name:	Korban
Title:	Researcher
Institution:	University of Illinois
Address:	Urbana, IL 61801, USA
Country:	USA
Email:	korban@illinois.edu

Publications


Year	Publication
2012	Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2009	Gasic K, Han Y, Kertbundit S, Shulaev V, Iezzoni AF, Stover EW, Bell RL, Wisniewski ME, Korban SS. Characteristics and transferability of new apple EST-derived SSRs to other Rosaceae species. Molecular Breeding. 2009; 23(3):397-411.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Apple-MM-F1	5	N/A	66.8	CN919347	View
2	Apple-M432-2012	LG5	N/A	64.7	CN919347	View

Alignments

Feature Name	Type	Location	Analysis
Chr05	chromosome	Chr05:6678254..6678495.	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr5B	chromosome	chr5B:6731718..6731959.	Malus x domestica ‘Honeycrisp’ Genome v1.1.a1 Assembly & Annotation