|
|
Marker Overview
| Name | SAmsCO903797 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Malus x domestica |
|---|
| Repeat Motif | (TC) 18.5 |
|---|
| Primer 1 | SAmsCO903797.Forward Primer: ATTGATATCACAGCTAAGCC |
|---|
| Primer 2 | SAmsCO903797.Reverse Primer: CCAAAATCTCAGAAACGGGG |
|---|
| Max Length | 410 |
|---|
| Publication | [view all] |
|---|
| Contact | Felicidad Fernandez-Fernandez
|
|---|
Alignments
The following features are aligned
Publications
| Year | Publication |
|---|
| 2012 | Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203. |
| 2012 | Fernández-Fernández F, Antanaviciute L, van Dyk MM, Tobutt KR, Evans KM, Rees DJG, Dunwell JM, Sargent DJ. A genetic linkage map of an apple rootstock progeny anchored to the Malus genome sequence. Tree genetics & genomes. 2012; 8(5):991-1002. |
|
