MEST161, MEST161 (genetic_marker) Malus x domestica | GDR

Marker Overview

Marker Overview


Name	MEST161
Genbank ID	AB627297
Type	SSR
Species	Malus x domestica
Repeat Motif	(ag)9
Primer 1	MEST161.Forward primer: cagagacatcagacagcgga
Primer 2	MEST161.Reverse primer: cagactccaaaacgacgaca
Publication	[view all]
Contact	Miyuki Kunihisa Shigeki Moriya

Contact

Name

Details

Miyuki Kunihisa

First name:	Miyuki
Last name:	Kunihisa
Institution:	NARO Institute of Fruit Tree Science
Address:	2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:	Japan
Email:	miyuky@affrc.go.jp
Phone:	81-29-838-6437
Keywords:	fruit drop

Shigeki Moriya

First name:	Shigeki
Last name:	Moriya
Title:	Researcher
Institution:	Apple Research StationNARO Institute of Fruit Tree Science
Address:	Apple Research Station, NARO Institute of Fruit Tree Science, Shimokuriyagawa, Morioka, Iwate 020-0123, Japan
Country:	Japan
Email:	moriyas@affrc.go.jp

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
chr6A	chromosome	chr6A:34649419..34649703 .	Malus x domestica ‘Honeycrisp’ Genome v1.1.a1 Assembly & Annotation	GDR marker alignment to genome using primer sequences

Publications


Year	Publication
2012	Moriya S, Iwanami H, Kotoda N, Haji T, Okada K, Terakami S, Mimida N, Yamamoto T, Abe K. Aligned genetic linkage maps of apple rootstock cultivar ‘JM7’ and Malus sieboldii ‘Sanashi 63’ constructed with novel EST-SSRs. Tree genetics & genomes. 2012; 8(4):709-723.
2014	Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Apple-OA-F1-Akane	AK6	N/A	63.4	MEST161	View
2	Apple-JM7xS63-F1	J6	N/A	51	MEST161	View
3	Apple-JM7xS63-F1	S6	N/A	58.7	MEST161	View