|
|
Marker Overview
| Name | CTG021286.277 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Malus x domestica |
|---|
| Repeat Motif | (CT)23 |
|---|
| Primer 1 | CTG021286.277.forward: CAACAAAGCCCTCTCCTCTC |
|---|
| Primer 2 | CTG021286.277.reverse: TGAGGTGCTTCTGCTGATTG |
|---|
| Publication | [view all] |
|---|
| Contact | Zhen Han
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Cui MS, Yang LL, Han YY, Zhang Q, Zhao YB, Li CM, Han YP, Wang Y, Chen DM, Yang FQ, Zhang XZ, Han ZH. Genetic mapping reveals sophisticated responses of Malus domestica to Botryosphaeria dothidea isolates. Journal of Phytopathology. 2015; 163:42–53. |
Relationships
This genetic_marker is adjacent to the following primer feature(s):
The following marker_locus feature(s) are an instance of this genetic_marker:
| Feature Name | Unique Name | Species | Type |
|---|
| CTG021286.277 | CTG021286.277 | Malus x domestica | marker_locus |
|
