WBGCAS12/13, WBGCAS12/13 (genetic_marker) Malus x domestica | GDR

Marker Overview

Marker Overview


Name	WBGCAS12/13
Genbank ID	N/A
Type	SSR
Species	Malus x domestica
Primer 1	WBGCAS12/13.forward primer: TGTGGCTTGAGGCATAAGGAAC
Primer 2	WBGCAS12/13.reverse primer: TGTTGCTCTTGCTGCCATGTC
Publication	[view all]
Contact	Yuepeng Han

Contact

Name

Details

Yuepeng Han

First name:	Yuepeng
Last name:	Han
Title:	Researcher
Institution:	Chinese Academy of Sciences
Address:	Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden, the Chinese Academy of Sciences, Wuhan 430074, People’s Republic of China
Country:	China
Email:	yphan@wbgcas.cn

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Chr13	chromosome	Chr13:16550470..16550647 .	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation	GDR marker alignment to genome using primer sequences
chr13A	chromosome	chr13A:15963063..15963240 .	Malus x domestica ‘Honeycrisp’ Genome v1.1.a1 Assembly & Annotation	GDR marker alignment to genome using primer sequences

Publications


Year	Publication
2012	Zhang Q, Ma B, Li H, Chang Y, Han Y, Li J, Wei G, Zhao S, Khan MA, Zhou Y, Gu C, Zhang X, Han Z, Korban SS, Li S, Han Y. Identification, characterization, and utilization of genome-wide simple sequence repeats to identify a QTL for acidity in apple. BMC genomics. 2012; 13:537.