|
|
Marker Overview
| Name | G20305_1806 |
|---|
| dbSNP ID | N/A |
|---|
| SNP Array ID | | 68K SNP array for rose: | Affx-86819259 |
|
|---|
| Type | SNP |
|---|
| SNP Alleles | N/A |
|---|
| Species | Rosa hybrida |
|---|
Alignments
The following features are aligned
| Feature Name | Type | Location | Analysis | Reference |
|---|
| Chr04 | chromosome | Chr04:53634041..53634041 . | Rosa chinensis Whole Genome v1.0 Assembly & Annotation | Lau, J., Gill, H., Taniguti, C. H., Young, E. L., Klein, P. E., Byrne, D. H., & Riera-Lizarazu, O. (2023). QTL discovery for resistance to black spot and cercospora leaf spot, and defoliation in two interconnected F1 bi-parental tetraploid garden rose populations. Frontiers in Plant Science, Section Plant Breeding, 14, 2023. |
| RcHm_v2.0_Chr4 | chromosome | RcHm_v2.0_Chr4:61931030..61931030 . | Rosa chinensis Old Blush homozygous genome v2.0 | Lau, J., Gill, H., Taniguti, C. H., Young, E. L., Klein, P. E., Byrne, D. H., & Riera-Lizarazu, O. (2023). QTL discovery for resistance to black spot and cercospora leaf spot, and defoliation in two interconnected F1 bi-parental tetraploid garden rose populations. Frontiers in Plant Science, Section Plant Breeding, 14, 2023. |
Sequence
>G20305_1806 ID=G20305_1806; Name=G20305_1806; organism=Rosa hybrida; type=genetic_marker; length=75bp
TTGAAAAGCAATTCGAGCAAAGAATTTCCTGGTAA[A/G]TTGAGAAAAA
GCGGCGCTTACTATTCACAACATCT
|
