|
|
Marker Overview
| Name | K6994_296 |
|---|
| dbSNP ID | N/A |
|---|
| SNP Array ID | | 68K SNP array for rose: | Affx-86786214 |
|
|---|
| Type | SNP |
|---|
| SNP Alleles | N/A |
|---|
| Species | Rosa hybrida |
|---|
Alignments
The following features are aligned
| Feature Name | Type | Location | Analysis | Reference |
|---|
| Chr06 | chromosome | Chr06:36447864..36447864 . | Rosa chinensis Whole Genome v1.0 Assembly & Annotation | Lau, J., Gill, H., Taniguti, C. H., Young, E. L., Klein, P. E., Byrne, D. H., & Riera-Lizarazu, O. (2023). QTL discovery for resistance to black spot and cercospora leaf spot, and defoliation in two interconnected F1 bi-parental tetraploid garden rose populations. Frontiers in Plant Science, Section Plant Breeding, 14, 2023. |
| RcHm_v2.0_Chr6 | chromosome | RcHm_v2.0_Chr6:39078345..39078345 . | Rosa chinensis Old Blush homozygous genome v2.0 | Lau, J., Gill, H., Taniguti, C. H., Young, E. L., Klein, P. E., Byrne, D. H., & Riera-Lizarazu, O. (2023). QTL discovery for resistance to black spot and cercospora leaf spot, and defoliation in two interconnected F1 bi-parental tetraploid garden rose populations. Frontiers in Plant Science, Section Plant Breeding, 14, 2023. |
Sequence
>K6994_296 ID=K6994_296; Name=K6994_296; organism=Rosa hybrida; type=genetic_marker; length=75bp
ATTCAATAACCACAGCAGTTCATTCGTTTTGTTTT[C/T]TGCAATCTTG
TCCTCCATCAGTCGAAACTAGCATT
|
