|
Marker Overview
Name | FB_AFFY_0377145 |
dbSNP ID | N/A |
SNP Array ID | 480K SNP array for apple: | AX-105185883 | 50K SNP array for apple: | AX-105185883 |
|
Type | SNP |
SNP Alleles | Y |
5' Flanking Sequence | TC |
3' Flanking Sequence | ATCACAATTCTCAATTCCGCCCTCCCCGTCTCCGC |
Species | Malus x domestica |
Publication | [view all] |
Alignments
The following features are aligned
Publications
Year | Publication |
2016 | Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26. |
2020 | Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8 |
Sequence
>FB_AFFY_0377145 ID=FB_AFFY_0377145; Name=FB_AFFY_0377145; organism=Malus x domestica; type=genetic_marker; length=42bp TC[C/T]ATCACAATTCTCAATTCCGCCCTCCCCGTCTCCGC
|