|
Marker Overview
Name | FB_AFFY_9846289 |
dbSNP ID | N/A |
SNP Array ID | 480K SNP array for apple: | AX-115525267 |
|
Type | SNP |
SNP Alleles | M |
Species | Malus x domestica |
Publication | [view all] |
Alignments
The following features are aligned
Publications
Year | Publication |
2016 | Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26. |
Sequence
>FB_AFFY_9846289 ID=FB_AFFY_9846289; Name=FB_AFFY_9846289; organism=Malus x domestica; type=genetic_marker; length=42bp AAAGAAAAGTTACAGAACTTATATTATATACTTGA[A/C]TG
|