RhABT12, RhABT12 (genetic_marker) Rosa hybrida | GDR

Marker Overview

Marker Overview


Name	RhABT12
Genbank ID	N/A
Type	SSR
Species	Rosa hybrida
Primer 1	RhABT12.F primer: CAAGTTTGTCTCCTTGGACC
Primer 2	RhABT12.R primer: CATAGATGATTATCCTAGAGCC
Product Length	280 (GG) 160 (FC)
Restriction Enzyme	PCR marker
Publication	[view all]
Contact	Dani Zamir Oron Gar Johan Van Huylenbroeck L. Leus

Contact

Name

Details

Dani Zamir

First name:	Dani
Last name:	Zamir
Institution:	The Hebrew university of Jerusalem
Address:	The Robert H. Smith Institute of Plant Sciences and Genetics in Agriculture, The Hebrew university of Jerusalem, P.O 12, Rehovot 76100, Israel.
Email:	zamir@agri.huji.ac.il
Phone:	972-8-9489250/092

Oron Gar

First name:	Oron
Last name:	Gar
Institution:	The Hebrew university of Jerusalem
Address:	The Robert H. Smith Institute of Plant Sciences and Genetics in Agriculture, The Hebrew university of Jerusalem, P.O 12, Rehovot 76100, Israel.

Johan Van Huylenbroeck

First name:	Johan
Last name:	Van Huylenbroeck
Institution:	Applied Genetics and Breeding, Plant Sciences Unit, Institute for Agricultural and Fisheries Research (ILVO)
Address:	Caritasstraat 21, 9090 Melle, Belgium
Country:	Belgium
Email:	johan.vanhuylenbroeck@ilvo.vlaanderen.be

L. Leus

First name:	L.
Last name:	Leus
Institution:	Applied Genetics and Breeding, Plant Sciences Unit, Institute for Agricultural and Fisheries Research (ILVO)
Address:	Caritasstraat 21, 9090 Melle, Belgium
Email:	leen.leus@ilvo.vlaanderen.be

Publications


Year	Publication
2003	Esselink GD, Smulders MJ, Vosman B. Identification of cut rose (Rosa hybrida) and rootstock varieties using robust sequence tagged microsatellite site markers. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2003 Jan; 106(2):277-86.
2005	Yan Z, Denneboom C, Hattendorf A, Dolstra O, Debener T, Stam P, Visser PB. Construction of an integrated map of rose with AFLP, SSR, PK, RGA, RFLP, SCAR and morphological markers. Theoretical and Applied Genetics. 2005 Feb; 110(4):766-777.
2011	Gar O, Sargent DJ, Tsai CJ, Pleban T, Shalev G, Byrne DH, Zamir D. An autotetraploid linkage map of rose (Rosa hybrida) validated using the strawberry (Fragaria vesca) genome sequence. PloS one. 2011; 6(5):e20463.
2010	Moghaddam HH, Leus L, Van Huylenbroeck J, Van Bockstaele E, Riek JD. Pathotype dependent resistance mapping for powdery mildew in a diploid rose population. Acta Hort. 2010. 870: 103-107
2012	Moghaddam HH, Leus L, De Riek J, Van Huylenbroeck J, Van Bockstaele E. Euphytica. 2012. 184:413–427

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Rose-94/1-F1	LG4B	N/A	72.76	RhABT12	View
2	Rose-YRW-F1-integrated	int.4	N/A	31.7	RhABT12	View
3	Rose-YRW-F1-R.wichurana	B4	N/A	34	RhABT12	View
4	Rose-FW-F1	4	N/A	2.72	RhABT12	View
5	Rose-Sun_City-F1	B7	N/A	60.5	RhABT12-149	View
6	Rose-Yunzheng_Xiawei-F1	A3	N/A	75.1	RhABT12-151	View
7	Rose-YXxSC_integrated-F1	LG04	N/A	18.7	RhABT12-149	View
8	Rose-J14-3xLC-F1	LG04	N/A	14.93	RhABT12_LG4	View
9	Rose-J14-3xVS-F1	LG04	N/A	12.42	RhABT12_LG4	View
10	Rose-OBxRF-F1	LG04	N/A	15.05	RhABT12_LG4	View
11	Rose-ICD-2018	LG04	N/A	29.73	RhABT12_LG4	View