CN889061, CN889061 (genetic_marker) Malus x domestica | GDR

Marker Overview

Marker Overview


Name	CN889061
Genbank ID	N/A
Type	SSR
Species	Malus x domestica
Repeat Motif	(TC)22
Primer 1	CN889061.forward primer: ATCCTTAAGCGCTCTCCACA
Primer 2	CN889061.reverse primer: ATTGCGAGCAAATCGGTATC
Max Length	500
Publication	[view all]
Contact	Schuyler Korban

Contact

Name

Details

Schuyler Korban

First name:	Schuyler
Last name:	Korban
Title:	Researcher
Institution:	University of Illinois
Address:	Urbana, IL 61801, USA
Country:	USA
Email:	korban@illinois.edu

Publications


Year	Publication
2014	Yuansheng Chang, Rui Sun, Huanhuan Sun, Yongbo Zhao, Yuepeng Han, Dongmei Chen, Yi Wang, Xinzhong Zhang, Zhenhai Han. Mapping of quantitative trait loci corroborates independent genetic control of apple size and shape. Scientia Horticulturae. 2014; 174:126–132.
2009	Gasic K, Han Y, Kertbundit S, Shulaev V, Iezzoni AF, Stover EW, Bell RL, Wisniewski ME, Korban SS. Characteristics and transferability of new apple EST-derived SSRs to other Rosaceae species. Molecular Breeding. 2009; 23(3):397-411.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Apple-JGD-F1-2014	G14	N/A	72.2	CN889061	View

Alignments

Feature Name	Type	Location	Analysis
Chr14	chromosome	Chr14:14779255..14779507.	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr14A	chromosome	chr14A:14994815..14995065.	Malus x domestica ‘Honeycrisp’ Genome v1.1.a1 Assembly & Annotation