WBGCAS11, WBGCAS11 (genetic_marker) Malus x domestica

Marker Overview
NameWBGCAS11
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Primer 1WBGCAS11.forward primer: CCTCTGCAACTCGAAAACCAAG
Primer 2WBGCAS11.reverse primer: TGTGCAGGATTACTGTTGTGTC
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerWBGCAS11.forward primerMalus x domesticaprimer
reverse primerWBGCAS11.reverse primerMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
WBGCAS11WBGCAS11Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-JGD-F1-2014G14N/A46.1WBGCAS11View