M18a, M18a (genetic_marker) Prunus persica | GDR

Marker Overview

Marker Overview


Name	M18a
Genbank ID	N/A
Type	SSR
Species	Prunus persica
Repeat Motif	(CT)6CC(CT)2CCCTCA(CT)3
Primer 1	M18a.Forward Primer: CTCCAATCTTTCCTCTACTCAA
Primer 2	M18a.Reverse Primer: AGCACTGCGTCTGAGATCTGAT
Publication	[view all]
Contact	Maria Badenes

Contact

Name

Details

Maria Badenes

First name:	Maria
Last name:	Badenes
Institution:	Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:	Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:	Spain
Email:	badenes_mlu@gva.es

Publications


Year	Publication
2005	Yamamoto T, Yamaguchi M, Hayashi T. An Integrated Genetic Linkage Map of Peach by SSR, STS, AFLP and RAPD. Journal of the Japanese Society for Horticultural Science. 2005; 74(3):204-213.

Alignments

Feature Name	Type	Location	Analysis
Pp01	chromosome	Pp01:8592094..8592681.	Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
PAV01_REGINA	chromosome	PAV01_REGINA:9014184..9014777.	Prunus avium Regina Genome v1.0 Assembly & Annotation
chr_1	chromosome	chr_1:13208672..13209265.	Prunus avium Tieton Genome v2.0 Assembly & Annotation
Pd01	chromosome	Pd01:8041473..8042061.	Prunus dulcis Lauranne Genome v1.0