MA060a, MA060a (genetic_marker) Prunus persica | GDR

Marker Overview

Marker Overview


Name	MA060a
Genbank ID	N/A
Type	SSR
Species	Prunus persica
Repeat Motif	(AG)4C(GA)5
Primer 1	MA060a.Forward Primer: TAAACTTTTAGAGGGGATGCT
Primer 2	MA060a.Reverse Primer: AGGCCTTCAATAGTATATCCAT
Publication	[view all]
Contact	Maria Badenes

Contact

Name

Details

Maria Badenes

First name:	Maria
Last name:	Badenes
Institution:	Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:	Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:	Spain
Email:	badenes_mlu@gva.es

Publications


Year	Publication
2005	Yamamoto T, Yamaguchi M, Hayashi T. An Integrated Genetic Linkage Map of Peach by SSR, STS, AFLP and RAPD. Journal of the Japanese Society for Horticultural Science. 2005; 74(3):204-213.

Alignments

Feature Name	Type	Location	Analysis
Pp02	chromosome	Pp02:757601..757701.	Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
PAV02_REGINA	chromosome	PAV02_REGINA:1247187..1247287.	Prunus avium Regina Genome v1.0 Assembly & Annotation
chr_2	chromosome	chr_2:7170043..7170143.	Prunus avium Tieton Genome v2.0 Assembly & Annotation
Pd02	chromosome	Pd02:709631..709731.	Prunus dulcis Lauranne Genome v1.0