|
|
Marker Overview
| Name | RPPG3-018 |
|---|
| Genbank ID | Pr032816748 |
|---|
| Type | SSR |
|---|
| Species | Prunus persica |
|---|
| Repeat Motif | (GT)14(GA)20 |
|---|
| PCR Condition | 50 |
|---|
| Primer 1 | RPPG3-018.forward primer: ATTCCTTCCCCTTTCCCTTC |
|---|
| Primer 2 | RPPG3-018.reverse primer: CCCAGCACGAACCACAAA |
|---|
| Publication | [view all] |
|---|
| Contact | Ignazio Verde
|
|---|
| Comment | Intergenic |
|---|
Publications
| Year | Publication |
|---|
| 2017 | Verde I, Jenkins J, Dondini L, Micali S, Pagliarani G, Vendramin E, Paris R, Aramini V, Gazza L, Rossini L, Bassi D, Troggio M, Shu S, Grimwood J, Tartarini S, Dettori MT, Schmutz J. The Peach v2.0 release: high-resolution linkage mapping and deep resequencing improve chromosome-scale assembly and contiguity. BMC genomics. 2017 Mar 11; 18(1):225. |
Alignments
| Feature Name | Type | Location | Analysis |
|---|
| Pp03 |
chromosome |
Pp03:8942693..8942936. |
Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1) |
|
