CGPPL5728, CGPPL5728 (genetic_marker) Prunus persica | GDR

Marker Overview

Marker Overview


Name	CGPPL5728
Genbank ID	AF495728
Type	candidate gene marker
Species	Prunus persica
Primer 1	CGPPL5728.forward primer: ATCGGAAGAAGGGAATTGCT
Primer 2	CGPPL5728.revers primer: ATTGGAGCTGGACTGTGCTT
Product Length	315
Publication	[view all]
Contact	Ignazio Verde
Comment	Ent-kaurene oxidase;Ko

Contact

Name

Details

Ignazio Verde

First name:	Ignazio
Last name:	Verde
Title:	researcher
Institution:	Istituto Sperimentale per la Frutticoltura (CRA)
Address:	Via di Fioranello 52, Ciampino Aeroporto, 00040 Rome, Italy
Country:	Italy
Email:	ignazio.verde@entecra.it
Phone:	(+39) 0679348183
Fax:	(+39) 0679341630
Keywords:	Peach

Publications


Year	Publication
2017	Verde I, Jenkins J, Dondini L, Micali S, Pagliarani G, Vendramin E, Paris R, Aramini V, Gazza L, Rossini L, Bassi D, Troggio M, Shu S, Grimwood J, Tartarini S, Dettori MT, Schmutz J. The Peach v2.0 release: high-resolution linkage mapping and deep resequencing improve chromosome-scale assembly and contiguity. BMC genomics. 2017 Mar 11; 18(1):225.
2011	Mol Breed. 2011. 28(4):667682

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Prunus-TxE-peachV2.0	LG1	N/A	35.7	CGPPL5728	View

Alignments

Feature Name	Type	Location	Analysis
Pp01	chromosome	Pp01:34728325..34728835.	Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
PAV01_REGINA	chromosome	PAV01_REGINA:40378955..40379463.	Prunus avium Regina Genome v1.0 Assembly & Annotation
chr_1	chromosome	chr_1:44384768..44385276.	Prunus avium Tieton Genome v2.0 Assembly & Annotation
Pd01	chromosome	Pd01:30419816..30420328.	Prunus dulcis Lauranne Genome v1.0