|
|
Marker Overview
| Name | CGPAA1525 |
|---|
| Genbank ID | CV051525 |
|---|
| Type | candidate gene marker |
|---|
| Species | Prunus persica |
|---|
| Primer 1 | CGPAA1525.forward primer: ATTCATCCCATTTCCACCAA |
|---|
| Primer 2 | CGPAA1525.revers primer: ATGCAAGCACAATCCAAACA |
|---|
| Product Length | 323 |
|---|
| Publication | [view all] |
|---|
| Contact | Ignazio Verde
|
|---|
| Comment | Pectin Methyl Esterase;Pme4 |
|---|
Publications
| Year | Publication |
|---|
| 2017 | Verde I, Jenkins J, Dondini L, Micali S, Pagliarani G, Vendramin E, Paris R, Aramini V, Gazza L, Rossini L, Bassi D, Troggio M, Shu S, Grimwood J, Tartarini S, Dettori MT, Schmutz J. The Peach v2.0 release: high-resolution linkage mapping and deep resequencing improve chromosome-scale assembly and contiguity. BMC genomics. 2017 Mar 11; 18(1):225. |
| 2011 | Mol Breed. 2011. 28(4):667682 |
Alignments
| Feature Name | Type | Location | Analysis |
|---|
| Pp02 |
chromosome |
Pp02:27936964..27937286. |
Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1) |
|
