|
Marker Overview
Name | Prudu2.01B |
Genbank ID | EU424259 |
Type | gene marker |
Species | Prunus dulcis |
Primer 1 | Prudu2.01B.forward primer: TTGCCCTGCCAATGTTAACGC |
Primer 2 | Prudu2.01B.revers primer: GCACTGGGTCTTAAAGAACTG |
Publication | [view all] |
Contact | Ignazio Verde
|
Publications
Year | Publication |
2017 | Verde I, Jenkins J, Dondini L, Micali S, Pagliarani G, Vendramin E, Paris R, Aramini V, Gazza L, Rossini L, Bassi D, Troggio M, Shu S, Grimwood J, Tartarini S, Dettori MT, Schmutz J. The Peach v2.0 release: high-resolution linkage mapping and deep resequencing improve chromosome-scale assembly and contiguity. BMC genomics. 2017 Mar 11; 18(1):225. |
2008 | Chen L, Zhang S, Illa E, Song L, Wu S, Howad W, Arús P, van de Weg E, Chen K, Gao Z. Genomic characterization of putative allergen genes in peach/almond and their synteny with apple. BMC genomics. 2008; 9:543. |
|