|
|
Marker Overview
| Name | EMpaS13 |
|---|
| Genbank ID | AY526629 |
|---|
| Type | SSR |
|---|
| Species | Prunus avium |
|---|
| Repeat Motif | (TC)11(GT)3 at(GT)5 |
|---|
| Primer 1 | EMpaS13.Forward primer: VIC-gaattgaagcaaccaagcac |
|---|
| Primer 2 | EMpaS13.Reverse primer: tggcacactctacctaacattc |
|---|
| Max Length | 213 |
|---|
| Publication | [view all] |
|---|
| Contact | Simon Vaughan
|
|---|
Alignments
The following features are aligned
Publications
| Year | Publication |
|---|
| 2008 | Olmstead JW, Sebolt AM, Cabrera A, Sooriyapathirana SS, Hammar S, Iriarte G, Wang D, Chen CY, van der Knaap E, Iezzoni AF. Construction of an intra-specific sweet cherry (Prunus avium L.) genetic linkage map and synteny analysis with the Prunus reference map. Tree Genetics and Genomes. 2008; 4(4):897-910. |
| 2004 | Vaughan SP and Russel K. Characterization of novel microsatellites and development of multiplex PCR for large-scale population studies in wild cherry, Prunus avium. Molecular Ecology Notes 2004 4:429-431 |
|
