|
Marker Overview
Name | C10694 |
Genbank ID | N/A |
Type | SSR |
Species | Prunus virginiana |
Repeat Motif | (GGT)5 |
Primer 1 | C10694.Forward primer: CTCAAAATTGTTGGCTGCAA |
Primer 2 | C10694.Reverse primer: CGTGTATGCAACGTTCTCGT |
Product Length | 220 |
Publication | [view all] |
Contact | Wenhao Dai
|
Publications
Year | Publication |
2012 | Wang H, Walla JA, Zhong S, Huang D, Dai W. Development and cross-species/genera transferability of microsatellite markers discovered using 454 genome sequencing in chokecherry (Prunus virginiana L.). Plant cell reports. 2012 Nov; 31(11):2047-55. |
2012 | Mentor-Marcel RA, Bobe G, Sardo C, Wang LS, Kuo CT, Stoner G, Colburn NH. Plasma cytokines as potential response indicators to dietary freeze-dried black raspberries in colorectal cancer patients. Nutrition and cancer. 2012 Aug; 64(6):820-5. |
|