ZFRIt039, ZFRIt039 (genetic_marker) Pyrus spp.

Marker Overview
NameZFRIt039
Genbank IDN/A
TypeSSR
SpeciesPyrus spp.
PCR Condition56
Primer 1ZFRIt039.forward primer: CATTGTTGTACCCCAAAAGTTG
Primer 2ZFRIt039.reverse primer: CGAGACACACGTCCCAATAA
Publication[view all]
ContactLei Wang
Contact
NameDetails
Lei Wang
First name:Lei
Last name:Wang
Institution:Xinjiang Agricultural University
Address:College of Horticulture & Forestry Sciences, Xinjiang Agricultural University, Urumqi 830052
Country:China
Email:ewlei@163.com
Phone:13653825516
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerZFRIt039.forward primerPyrus spp.primer
reverse primerZFRIt039.reverse primerPyrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
ZFRIt039ZFRIt039-134.072Pyrus spp.marker_locus
ZFRIt039ZFRIt039-136.752Pyrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pear-M-F1-maleLG11N/A134.07ZFRIt039View
2Pear-RM-F1-IntegratedLG11N/A136.75ZFRIt039View