|
Marker Overview
Name | ZFRIt065 |
Genbank ID | N/A |
Type | SSR |
Species | Pyrus spp. |
PCR Condition | 56 |
Primer 1 | ZFRIt065.forward primer: GGGAAATGCTCTAATCTGCAA |
Primer 2 | ZFRIt065.reverse primer: CCCATCATAAATCAATCCCACT |
Publication | [view all] |
Contact | Lei Wang
|
Publications
Year | Publication |
2016 | Wang, L., Wang, L., Xue, H.B., Li, X.G., Li, J. Construction of SSR genetic linkage map and comparison on pears. Sci. Agric. Sinica. 2016. 49 (12), 2353–2367 |
Relationships
This genetic_marker is adjacent to the following primer feature(s):
Feature Name | Unique Name | Species | Type |
forward primer | ZFRIt065.forward primer | Pyrus spp. | primer |
reverse primer | ZFRIt065.reverse primer | Pyrus spp. | primer |
The following marker_locus feature(s) are an instance of this genetic_marker:
Feature Name | Unique Name | Species | Type |
ZFRIt065 | ZFRIt065-23.95 | Pyrus spp. | marker_locus |
ZFRIt065 | ZFRIt065-36.021 | Pyrus spp. | marker_locus |
ZFRIt065 | ZFRIt065-35.237 | Pyrus spp. | marker_locus |
|