|
Marker Overview
Name | AX-89817897 |
dbSNP ID | N/A |
SNP Array ID | 90K SNP array for cultivated strawberry: | Affx-88811304 | 50K SNP array for cultivated strawberry: | Affx-88811304 | 850K SNP array for cultivated strawberry: | Affx-88811304 | 35K SNP array for cultivated strawberry: | Affx-88811304 |
|
Type | SNP |
SNP Alleles | A/C |
Probe 1 | AX-89817897.AX-89817897: TCCTTGTATTTTAAGTCGACGTCTTGCTAG |
5' Flanking Sequence | GGATCAGGAACATAAAATTCAGCTGCAGAACGATC |
3' Flanking Sequence | GGGATGCCAATTTCCCACAATGTTGGTCCACTTCT |
Species | Fragaria x ananassa |
Publication | [view all] |
Contact | Nahla Bassil S Verma
|
Alignments
The following features are aligned
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
Year | Publication |
2015 | Bassil NV, Davis TM, Zhang H, Ficklin S, Mittmann M, Webster T, Mahoney L, Wood D, Alperin ES, Rosyara UR, Koehorst-Vanc Putten H, Monfort A, Sargent DJ, Amaya I, Denoyes B, Bianco L, van Dijk T, Pirani A, Iezzoni A, Main D, Peace C, Yang Y, Whitaker V, Verma S, Bellon L, Brew F, Herrera R, van de Weg E. Development and preliminary evaluation of a 90 K Axiom SNP array for the allo-octoploid cultivated strawberry Fragaria × ananassa. BMC genomics. 2015 Dec; 16(1):1310. |
2020 | Hardigan Michael A., Feldmann Mitchell J., Lorant Anne, Bird Kevin A., Famula Randi, Acharya Charlotte, Cole Glenn, Edger Patrick P., Knapp Steven J. Genome Synteny Has Been Conserved Among the Octoploid Progenitors of Cultivated Strawberry Over Millions of Years of Evolution. Front. Plant Sci., 2020 February 7; 10:1789 | https://doi.org/10.3389/fpls.2019.01789 |
2018 | Pincot DDA, Poorten TJ, Hardigan MA, Harshman JM, Acharya CB, Cole GS, Gordon TR, Stueven M, Edger PP, Knapp SJ. Genome-Wide Association Mapping Uncovers Fw1, a Dominant Gene Conferring Resistance to Fusarium Wilt in Strawberry. G3 (Bethesda). 2018 Mar 30; 8(5):1817-1828. |
2017 | Verma S, Bassil NV, van de Weg E, Harrison RJ, Monfort A, Hidalgo JM, Amaya I, Denoyes B, Mahoney L, Davis TM, Fan Z, Knapp S, Whitaker VM. Development and evaluation of the Axiom IStraw35 384HT array for the allo-octoploid cultivated strawberry Fragaria x ananassa. Acta Hortic. (1156): 75–82. 10.17660/ActaHortic.2017.1156.10. |
Sequence
>AX-89817897 ID=AX-89817897; Name=AX-89817897; organism=Fragaria x ananassa; type=genetic_marker; length=71bp GGATCAGGAACATAAAATTCAGCTGCAGAACGATCMGGGATGCCAATTTC CCACAATGTTGGTCCACTTCT
|