NAUpy20b, NAUpy20b (genetic_marker) Pyrus x bretschneideri | GDR

Marker Overview

Marker Overview


Name	NAUpy20b
Genbank ID	N/A
Type	SSR
Species	Pyrus x bretschneideri
Primer 1	NAUpy20b.forward primer: TGGACAAAATACCACCACTACC
Primer 2	NAUpy20b.reverse primer: GGAGGATGAAGGGAGGGA
Publication	[view all]
Contact	Jun Wu

Contact

Name

Details

Jun Wu

First name:	Jun
Last name:	Wu
Institution:	Nanjing Agricultural University
Address:	College of Horticulture, State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing 210095, China
Country:	China
Email:	wujun@njau.edu.cn
Last update:	Jan 2019

Publications


Year	Publication
2015	Chen H, Song Y, Li L, Khan M, Korban S, Wu J, Zhang S. Construction of a High-Density Simple Sequence Repeat Consensus Genetic Map for Pear (Pyrus spp.). Plant Molecular Biology Reporter. 2015; 33(2):316–325.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Pear-BD-F1-2015	LG2	N/A	91.3	NAUpy20b	View
2	Pear-Bayuehong-F1-2015	LG2	N/A	91.14	NAUpy20b	View
3	Pear-Dangshansuli-F1-2015	LG2	N/A	92.15	NAUpy20b	View
4	Pear-integrated_consensus_map-IPCG-2017	LG2	N/A	131.66	NAUpy20b	View
5	Pear-Rcf-F1-female	LG2	N/A	77.53	NAUpy20b	View
6	Pear-M-F1-male	LG2	N/A	94.74	NAUpy20b	View
7	Pear-RM-F1-Integrated	LG2	N/A	88.54	NAUpy20b	View