NAUpy39n, NAUpy39n (genetic_marker) Pyrus x bretschneideri

Marker Overview
NameNAUpy39n
Genbank IDN/A
TypeSSR
SpeciesPyrus x bretschneideri
Repeat MotifTC*21
Primer 1NAUpy39n.forward primer: GATCGTGTTTATGATTGTTGCTTCAATTT
Primer 2NAUpy39n.reverse primer: CCATTTTAAAGTCCCTCCCCA
Product Length143
Publication[view all]
ContactJun Wu
Contact
NameDetails
Jun Wu
First name:Jun
Last name:Wu
Institution:Nanjing Agricultural University
Address:College of Horticulture, State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing 210095, China
Country:China
Email:wujun@njau.edu.cn
Last update:Jan 2019
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerNAUpy39n.forward primerPyrus x bretschneideriprimer
reverse primerNAUpy39n.reverse primerPyrus x bretschneideriprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAUpy39nNAUpy39n-41.425Pyrus x bretschneiderimarker_locus
NAUpy39nNAUpy39n-44.105Pyrus x bretschneiderimarker_locus
NAUpy39nNAUpy39n-64.7Pyrus x bretschneiderimarker_locus
NAUpy39nNAUpy39n-65.119Pyrus x bretschneiderimarker_locus
NAUpy39nNAUpy39n-63.816Pyrus x bretschneiderimarker_locus
NAUpy39nNAUpy39n-135.68Pyrus x bretschneiderimarker_locus


Sequence
>NAUpy39n ID=NAUpy39n|Name=NAUpy39n|organism=Pyrus x bretschneideri|type=genetic_marker|length=143bp
CCATTTTAAAGTCCCTCCCCATAGACTTCTTCCTCTCTTACTTCATCTTC
ATGCTTGCAACCTGATCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT
CTCTCTCAGCTGAAAAATTGAAGCAACAATCATAAACACGATC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pear-M-F1-maleLG11N/A41.43NAUpy39nView
2Pear-RM-F1-IntegratedLG11N/A44.11NAUpy39nView
3Pear-BD-F1-2015LG11N/A64.7NAUpy39nView
4Pear-Bayuehong-F1-2015LG11N/A65.12NAUpy39nView
5Pear-Dangshansuli-F1-2015LG11N/A63.82NAUpy39nView
6Pear-integrated_consensus_map-IPCG-2017LG11N/A135.68NAUpy39nView