|
Marker Overview
Name | z71981 |
Genbank ID | N/A |
Type | SSR |
Species | Malus x domestica |
Primer 1 | z71981.forward primer: GCACTTACCTTTGTTGGGTCA |
Primer 2 | z71981.reverse primer: CCGGCATTCCAAATGTAACT |
Publication | [view all] |
Contact | Andrea Patocchi
|
Publications
Year | Publication |
2006 | Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224. |
|