evm.TU.contig279.911

Gene Overview
Nameevm.TU.contig279.911
Unique Nameevm.TU.contig279.911_ppc_v1.0
Typegene
OrganismPrunus persica (Peach)
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Prunus persica Chinese Cling Whole Genome v1.0 Assembly & Annotation2020-11-26
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
evm.model.contig279.911evm.model.contig279.911_ppc_v1.0Prunus persicamRNA


Alignments
Feature NameTypeLocationAnalysis
chr1 chromosome chr1:8408692..8410552+ Prunus persica Chinese Cling Whole Genome v1.0 Assembly & Annotation
Sequences
The following sequences are available for this feature:

gene from alignment at chr1:8408692..8410552+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>evm.TU.contig279.911_ppc_v1.0 ID=evm.TU.contig279.911_ppc_v1.0; Name=evm.TU.contig279.911; organism=Prunus persica; type=gene; length=1861bp; location=Sequence derived from: chr1:8408692..8410552+ (Prunus persica
ATGGACTCCAACGAAGCTGAGCTCTCTTTTCTTTCTCCTTCCCTCTCCCC AACCCGCAGGTAATATAAACATGCTCTCTCTCTCTATACGTGATTTCAGC ATATTTTTTTTAGTACAAGTAATTGGGGGATAATGTTTTACACAAATATT CATTGGGTGTGTTGGGTTTTGAATATATGCGCCCACATGGGTGGCGGAGC CACACCATATTTTTATCTCTCTTCTATTATATTATATATAACATATAGAA TTTGTAATAACTTATAATTTAAGTTATAGTTCTTTTTAAAATAAATTAGA CTAAATTATAAATATTTAGCTCTAAATATGTAATTATTGAATACTTAGGT GTTTTATATACTTGTATTTTCTACTTTACCCCCTAACTTTACAATTCTAG CTCCGTCCTTAGGTGGAGGTGAGAGAGCTCAACCAATTGAATTATACCCA TTGACATTTTATTTTGTCGGATATGATCATAAATATAATGTTGTTGGGAA ATTGTGCTGTAATTTTCTTTCCTCCTCAAAATAATGATAATAATAATAAG AATTAACGTGGACATTATTAAATTTTCATGGCTGGGGAAGATGGTGGTCG GAGGACACAGTAGCCATAGTTACTGGTGCAAACAAGGGCATTGGGTTTGC GCTTGTGAAGAGGATGGCGGAGTTAGGGGTGACGGTCATATTAACAGCCC GAGACATTGAAAGGGGTTGCAAAGCTGTGGAGGCTCTGAGAGCCCAAGGT CTTTACAATGTAGCCTTCTCTTGCCTCGATGTATCGGACCCTTCTTCAAT CAGAGCATTCACATCCTGGTTCAGCAAACGCTATGCAGCCTTGGATATTC TTGTAATATTAAGTTTTCTCTTCCCCACCATACCATTCCAAGTTAATTAT TTTACATTTATTGATCACTTCACTGACCATTTCTATTAGGTGGGTCTCAC TAATATACGTGGGACTCATATATATTAGAGAAGTGATTAGTAATGTGATA TATATATTTGCGGTGATGTATATAGTGTTACATATATAATATTGACCTAA AAATTGGGCTAATTTTTGAAAATTCAAGGTAAACAATGCAGCTGTGTCGT TTAATGATCTCAATGAAAACTCGGTGGAACATGCGGAGACAGTGATGAAA ACCAATTTCTATGGACCCAAGTTGCTGACTGAGGCCCTCTTGCCCATGTT TCGTAGCTCTTCCTCAGTAAGTCGGATTCTTAACGTTAGCTCCAGACTTG GCTCACTAAATGTAAGTGAAACAATTTTATAAATAGTTATATATATAAAT TCTTCTATGCGGACGTCCAGATGTTATTACCATGTATCTCTGCTTTCTTC CCTATTTACATTGACATTCGCATGGTGATAACGTACGGTCATCCGGATGA TTGAATAACTATACTTATGTAAAATATATATATTTTAGTTGCTCAAATTA TATATGGCCTTGCAGCAGCTAAGAAACCCTAGCATAAAACAAGTTATGAA AAGTGAAAGACTATCGGAAGAGGAGATTGAAGGGGTGGTTAATTTGTTTC TCGACGACGTGAAGAGCGGCACATGGAAGAGCAAAGGGTGGCCGAAATTA TGGACCGACTATGCTGTGTCAAAGCTTGCACTCAACGCATATACAAGAGT TTTGGCAAAGCGATATGAGGGAAGGGGTTTGAGTGTGAATAGCTTCTGTC CAGGCTTCACACAGACATCTATGACTCATTGTAAGGGCGACCACACCGCA GATGATGCCGCGGGTATGGCTGCTAGGCTGGCCTTGCTTCCTTCTCACCA GATTCCATCTGGAAAATTTTTCTTCTGGGGTAGTAGTAATGCTATTTCCT CTAAATTATAG
back to top