SFB12, SFB12 (gene) Eriobotrya japonica

Gene Overview
Name SFB12
Gene Symbol SFB12
Type gene
Organism Eriobotrya japonica
Synonym S-haplotype-specific F-box protein
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB12KR149308.1-SFB12Eriobotrya japonicagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB12KR149308.1-SFB12.m1Eriobotrya japonicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBEriobotrya japonicagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KR149308.1-SFB12 N/A KR149308.1
mRNA parsed from NCBI nr database KR149308.1-SFB12.m1 N/A KR149308.1

Sequence(s):
>KR149308.1-SFB121135
atgtctcaggtgtgtgaaagtgaaactcctgaagatagaacggtcgaaatcttgtccaggttaccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaagagagttggaaa
caagaagttatatggtccgtgattaatctttccattgatggcgatgagcttcattatgatattgaggacctaactaatgt
accgtttctaaaggatgaccatcatgaagtagagattcacggttattgcgacgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaatttggattggaaacgacccttaaaggtctgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagatgatggagaaacatatatcgagcatattgctcttcctcacactg
ctgaagtatacaccatggccgctaactcttggaaagagatcacgattgatatattaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtgtttgaaagggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagagttgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccatcacttattattgcactagttacgaggagccttccacattatttgaaatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaacagctggaccttttaaagacatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattacctccgatggaagagctgcctcttataattcttgtaccgaaaatttcaagtatc
ttcatattcctgcga
back to top
>KR149308.1-SFB12.m11135
atgtctcaggtgtgtgaaagtgaaactcctgaagatagaacggtcgaaatcttgtccaggttaccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaagagagttggaaa
caagaagttatatggtccgtgattaatctttccattgatggcgatgagcttcattatgatattgaggacctaactaatgt
accgtttctaaaggatgaccatcatgaagtagagattcacggttattgcgacgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaatttggattggaaacgacccttaaaggtctgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagatgatggagaaacatatatcgagcatattgctcttcctcacactg
ctgaagtatacaccatggccgctaactcttggaaagagatcacgattgatatattaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtgtttgaaagggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagagttgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccatcacttattattgcactagttacgaggagccttccacattatttgaaatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaacagctggaccttttaaagacatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattacctccgatggaagagctgcctcttataattcttgtaccgaaaatttcaagtatc
ttcatattcctgcga
back to top